Raw JSON
{'hasResults': True, 'derivedSection': {'miscInfoModule': {'versionHolder': '2025-12-24', 'removedCountries': ['Austria', 'Germany', 'Spain']}, 'conditionBrowseModule': {'meshes': [{'id': 'D018450', 'term': 'Disease Progression'}, {'id': 'D002289', 'term': 'Carcinoma, Non-Small-Cell Lung'}, {'id': 'D002292', 'term': 'Carcinoma, Renal Cell'}], 'ancestors': [{'id': 'D020969', 'term': 'Disease Attributes'}, {'id': 'D010335', 'term': 'Pathologic Processes'}, {'id': 'D013568', 'term': 'Pathological Conditions, Signs and Symptoms'}, {'id': 'D002283', 'term': 'Carcinoma, Bronchogenic'}, {'id': 'D001984', 'term': 'Bronchial Neoplasms'}, {'id': 'D008175', 'term': 'Lung Neoplasms'}, {'id': 'D012142', 'term': 'Respiratory Tract Neoplasms'}, {'id': 'D013899', 'term': 'Thoracic Neoplasms'}, {'id': 'D009371', 'term': 'Neoplasms by Site'}, {'id': 'D009369', 'term': 'Neoplasms'}, {'id': 'D008171', 'term': 'Lung Diseases'}, {'id': 'D012140', 'term': 'Respiratory Tract Diseases'}, {'id': 'D000230', 'term': 'Adenocarcinoma'}, {'id': 'D002277', 'term': 'Carcinoma'}, {'id': 'D009375', 'term': 'Neoplasms, Glandular and Epithelial'}, {'id': 'D009370', 'term': 'Neoplasms by Histologic Type'}, {'id': 'D007680', 'term': 'Kidney Neoplasms'}, {'id': 'D014571', 'term': 'Urologic Neoplasms'}, {'id': 'D014565', 'term': 'Urogenital Neoplasms'}, {'id': 'D052776', 'term': 'Female Urogenital Diseases'}, {'id': 'D005261', 'term': 'Female Urogenital Diseases and Pregnancy Complications'}, {'id': 'D000091642', 'term': 'Urogenital Diseases'}, {'id': 'D007674', 'term': 'Kidney Diseases'}, {'id': 'D014570', 'term': 'Urologic Diseases'}, {'id': 'D052801', 'term': 'Male Urogenital Diseases'}]}}, 'resultsSection': {'moreInfoModule': {'pointOfContact': {'email': 'ClinicalTrials.gov_Inquiries@pfizer.com', 'phone': '1-800-718-1021', 'title': 'Pfizer ClinicalTrials.gov Call Center', 'organization': 'Pfizer, Inc.'}, 'certainAgreement': {'otherDetails': 'Pfizer has the right to review disclosures, requesting a delay of less than 60 days. Investigator will postpone single center publications until after disclosure of pooled data (all sites), less than 12 months from study completion/termination at all participating sites. Investigator may not disclose previously undisclosed confidential information other than study results.', 'restrictionType': 'OTHER', 'piSponsorEmployee': False, 'restrictiveAgreement': True}, 'limitationsAndCaveats': {'description': 'Because of given challenges with study enrollment that were compounded by the global COVID-19 pandemic, and the observed high failure rate of tumor biospecimen analyses due to limitations in sample quality and quantity, the study was terminated in October 2020, which was not due to safety concerns or regulatory interactions. For endpoints with no data collected, no results can be disclosed.'}}, 'adverseEventsModule': {'timeFrame': "From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.", 'eventGroups': [{'id': 'EG000', 'title': 'Cohort 1: NSCLC Monotherapy', 'description': 'Progressive disease on 1st line monotherapy anti-PD-1/-L1.', 'otherNumAtRisk': 1, 'deathsNumAtRisk': 1, 'otherNumAffected': 0, 'seriousNumAtRisk': 1, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG001', 'title': 'Cohort 2: NSCLC Combination', 'description': 'Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.', 'otherNumAtRisk': 4, 'deathsNumAtRisk': 4, 'otherNumAffected': 0, 'seriousNumAtRisk': 4, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG002', 'title': 'Cohort 3: RCC With Clear Cell Component', 'description': 'Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.', 'otherNumAtRisk': 5, 'deathsNumAtRisk': 5, 'otherNumAffected': 0, 'seriousNumAtRisk': 5, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG003', 'title': 'Cohort 4: HR+ HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.', 'otherNumAtRisk': 10, 'deathsNumAtRisk': 10, 'otherNumAffected': 1, 'seriousNumAtRisk': 10, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG004', 'title': 'Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on enzalutamide monotherapy.', 'otherNumAtRisk': 5, 'deathsNumAtRisk': 5, 'otherNumAffected': 1, 'seriousNumAtRisk': 5, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG005', 'title': 'Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on abiraterone in combination with prednisone.', 'otherNumAtRisk': 10, 'deathsNumAtRisk': 10, 'otherNumAffected': 0, 'seriousNumAtRisk': 10, 'deathsNumAffected': 0, 'seriousNumAffected': 0}, {'id': 'EG006', 'title': 'Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.', 'otherNumAtRisk': 1, 'deathsNumAtRisk': 1, 'otherNumAffected': 0, 'seriousNumAtRisk': 1, 'deathsNumAffected': 0, 'seriousNumAffected': 0}], 'otherEvents': [{'term': 'Post procedural contusion', 'stats': [{'groupId': 'EG000', 'numAtRisk': 1, 'numAffected': 0}, {'groupId': 'EG001', 'numAtRisk': 4, 'numAffected': 0}, {'groupId': 'EG002', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG003', 'numAtRisk': 10, 'numAffected': 1}, {'groupId': 'EG004', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG005', 'numAtRisk': 10, 'numAffected': 0}, {'groupId': 'EG006', 'numAtRisk': 1, 'numAffected': 0}], 'organSystem': 'Injury, poisoning and procedural complications', 'assessmentType': 'NON_SYSTEMATIC_ASSESSMENT', 'sourceVocabulary': 'MedDRA version 23.1'}, {'term': 'Syncope', 'stats': [{'groupId': 'EG000', 'numAtRisk': 1, 'numAffected': 0}, {'groupId': 'EG001', 'numAtRisk': 4, 'numAffected': 0}, {'groupId': 'EG002', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG003', 'numAtRisk': 10, 'numAffected': 0}, {'groupId': 'EG004', 'numAtRisk': 5, 'numAffected': 1}, {'groupId': 'EG005', 'numAtRisk': 10, 'numAffected': 0}, {'groupId': 'EG006', 'numAtRisk': 1, 'numAffected': 0}], 'organSystem': 'Nervous system disorders', 'assessmentType': 'NON_SYSTEMATIC_ASSESSMENT', 'sourceVocabulary': 'MedDRA version 23.1'}, {'term': 'Dermatitis contact', 'stats': [{'groupId': 'EG000', 'numAtRisk': 1, 'numAffected': 0}, {'groupId': 'EG001', 'numAtRisk': 4, 'numAffected': 0}, {'groupId': 'EG002', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG003', 'numAtRisk': 10, 'numAffected': 1}, {'groupId': 'EG004', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG005', 'numAtRisk': 10, 'numAffected': 0}, {'groupId': 'EG006', 'numAtRisk': 1, 'numAffected': 0}], 'organSystem': 'Skin and subcutaneous tissue disorders', 'assessmentType': 'NON_SYSTEMATIC_ASSESSMENT', 'sourceVocabulary': 'MedDRA version 23.1'}, {'term': 'Procedural pain', 'stats': [{'groupId': 'EG000', 'numAtRisk': 1, 'numAffected': 0}, {'groupId': 'EG001', 'numAtRisk': 4, 'numAffected': 0}, {'groupId': 'EG002', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG003', 'numAtRisk': 10, 'numAffected': 1}, {'groupId': 'EG004', 'numAtRisk': 5, 'numAffected': 0}, {'groupId': 'EG005', 'numAtRisk': 10, 'numAffected': 0}, {'groupId': 'EG006', 'numAtRisk': 1, 'numAffected': 0}], 'organSystem': 'Injury, poisoning and procedural complications', 'assessmentType': 'NON_SYSTEMATIC_ASSESSMENT', 'sourceVocabulary': 'MedDRA version 23.1'}], 'frequencyThreshold': '0'}, 'outcomeMeasuresModule': {'outcomeMeasures': [{'type': 'PRIMARY', 'title': 'Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'groups': [{'id': 'OG000', 'title': 'HR+ HER2- Adenocarcinoma of the Breast With NGS Results', 'description': 'Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.'}, {'id': 'OG001', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate With NGS Results', 'description': 'Participants in Cohort 5 \\& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.'}, {'id': 'OG002', 'title': 'HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results', 'description': 'Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.'}, {'id': 'OG003', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results', 'description': 'Participants in Cohort 5 \\& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.'}], 'classes': [{'title': 'AKT1 c.238T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ARHGAP39 c.2000G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ARHGAP39 c.2085G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ARID1A c.3145_3146dupCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ARID1A c.3977dupC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'ARID2 c.1803dupG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'ASXL1 c.1934dupG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ATM c.5557G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ATM c.5948A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'AXIN1 c.1881G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'BAP1 c.179G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'BCLAF1 c.615_619delATCAGinsGTCAT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'BCOR c.476C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'BRCA1 c.2612C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'BRCA1 c.3113A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'BRCA1 c.3548A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'BRCA1 c.4837A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'BRCA1 c.4956G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'BRCA2 c.1114A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'BRCA2 c.2803G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'BRCA2 c.7397T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'BRCA2 c.9976A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'BRIP1 c.14G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BRIP1 c.2755T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CBR3 c.730G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'CCNE1 c.1117G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'CD22 c.757G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'CD3EAP c.1516C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'CDH1 c.1269delT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'CDH1 c.466T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'CREBBP c.1792C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'CSF3R c.14G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'DNM2 c.1782-5delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'DPYD c.1471G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'DYNC2H1 c.1714A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ECH1 c.122A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ERBB2 c.1958C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ERBB2 c.2446C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ERCC5 c.440C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ESR1 c.1609T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ESR1 c.1610_1613delATGAinsGTGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ESR1 c.1613A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM175A c.826_828delGAG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FANCA c.2426G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FANCD2 c.1214A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FANCE c.17C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-16.7', 'upperLimit': '28.9'}]}]}, {'title': 'FAT1 c.3818A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FGF9 c.375T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'FGFR1 c.358+4G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FGFR1OP c.985-6_985-5dupTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FLT4 c.1019G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FOXA1 c.247G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FOXA1 c.801G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'FOXA1 c.874G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FOXQ1 c.1013A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FOXQ1 c.895G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FRS2 c.236G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'GATA2 c.527C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'GATA3 c.1223_1224insA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'GNAS c.521G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'GOT2 c.1037T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'HEATR1 c.6347-4_6347-3dupTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'IRF2 c.744G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'IRS2 c.3170G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ITPKB c.1222T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'JAK1 c.1252G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'JAK2 c.2743G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'JAK3 c.757A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'KDM6A c.2859-5delT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'KDR c.2921G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'KMT2C c.2536delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'KMT2C c.4270C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'LMAN1 c.823-2dupA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'LRP1B c.143A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'LRP1B c.5737G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'LTN1 c.1717A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'LYN c.475G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MAP2K4 c.179C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'MED12 c.1364G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MGMT c.520A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MGMT c.626A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MLH1 c.655A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MSH2 c.1748A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MSH6 c.116G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MSH6 c.3557-4dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MTHFR c.1286A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'MUTYH c.1014G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MUTYH c.1187G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MYB c.1781C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'NBN c.553G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '-33.3', 'groupId': 'OG001', 'lowerLimit': '-70.0', 'upperLimit': '18.7'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'NBN c.683T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'NCOR1 c.4135G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'NCOR2 c.1597G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'NF1 c.7063-1G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'NF1 c.849T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'NOTCH1 c.2588-4G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'NOTCH2 c.3522+3G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'NOTCH3 c.539C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'NTRK1 c.1806-4delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'NUP98 c.3310G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PALB2 c.1676A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PALB2 c.2014G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PIK3CA c.1035T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'PIK3CA c.1633G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PIK3CA c.3140A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'PIK3CG c.41A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PLCG2 c.2011A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PMS2 c.13G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'PMS2 c.1408C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PMS2 c.1454C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PMS2 c.1621A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PMS2 c.2570G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '33.3', 'groupId': 'OG001', 'lowerLimit': '-18.7', 'upperLimit': '70.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PMS2 c.89A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'POLD1 c.2959delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PRKDC c.6424C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PTCH1 c.3746C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PTCH2 c.2134G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PTPN13 c.4097T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PTPN13 c.5683A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PTPN13 c.6256T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PUS3 c.1380G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'RAD51C c.376G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RAD51D c.494G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RIT1 c.625G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RNF43 c.1252C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ROS1 c.1775_1777delGTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RSF1 c.3025G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'SF3B1 c.2077+4A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SOD2 c.47T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'SYNE1 c.18758G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TBC1D12 c.1246C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'TBC1D9B c.3356A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'TBX3 c.364G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TBX3 c.820_827dupCCCGAAAC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TCF3 c.737C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'TERT c.215G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'TGFBR2 c.530-4T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TP53 c.215C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TP53 c.388delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TP53 c.782+1G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TUSC3 c.99_101delGCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ZFHX3 c.10931G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ZFHX3 c.1135C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG000', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'ZFHX3 c.1631C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ZFHX3 c.2833T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG000', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ALK c.1043C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'APLNR c.349G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'CARD11 c.988G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'CHD4 c.4060G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'EGFR c.1008G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'EP300 c.6613A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ERCC6 c.3661C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ERG c.1455_1461delCTACTAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'EZH2 c.848C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'FBXO11 c.164_169delAGCAGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'FLT4 c.2405G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'FOXO1 c.302C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'GNAQ c.303C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'HOTS c.233_236delTACTinsCACC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'IRS2 c.1242C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'KDM5C c.3019C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'KIT c.597delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'KMT2A c.9400C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'KMT2B c.26G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'KMT2C c.4845G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LRP1B c.4439G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MAGEA10 c.1021G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'MAP3K1 c.4292A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MET c.2318C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MSH6 c.1186C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MSH6 c.1486T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'MUTYH c.64G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MYH11 c.5819dupC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'NF1 c.1082G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'NOTCH2 c.17_18delCC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'NTRK3 c.137G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PALB2 c.2993G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PALLD c.270_275dupCCCGCC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PAX8 c.352G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PDGFRB c.1543G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}, {'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PIK3R1 c.1690A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PIK3R1 c.935delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PIK3R2 c.2047T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PLCG1 c.1825C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PLCG2 c.2114G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PMS2 c.1789A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'PMS2 c.706-4delT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'PTEN c.900delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'PTPRD c.2069A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'RB1 c.1466G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'RNF139 c.135C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ROS1 c.3416A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}, {'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'SPOP c.260A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'SYNE1 c.25403G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TCF3 c.1643G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'TEP1 c.3649C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}]}]}, {'title': 'TP53 c.993G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'TP53 c.994-2A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'U2AF1 c.101C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-16.7', 'groupId': 'OG001', 'lowerLimit': '-56.4', 'upperLimit': '28.9'}]}]}, {'title': 'ZFHX3 c.11065A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '16.7', 'groupId': 'OG001', 'lowerLimit': '-28.9', 'upperLimit': '56.4'}]}]}, {'title': 'AATK c.65C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ABCC9 c.4535C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ACADS c.989G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ACAP3 c.1990C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ACSL4 c.106G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ADAMTS13 c.3287G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ADAMTS7 c.227G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ADCY5 c.778C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ADGRE2 c.934C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ADGRE3 c.1411G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ADGRF2 c.680C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ADGRG3 c.1394C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ADH4 c.1174delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'AEBP1 c.799G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'AGFG2 c.340C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'AGPAT4 c.853C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'AGRN c.184C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'AGRN c.3157G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'AHNAK2 c.13479G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'AHNAK2 c.9650T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'AKNA c.3907T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ALS2CL c.14A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ANKRD61 c.323C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ANKS1A c.157_159delGGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ANKS1B c.2548C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ANTXR1 c.1121A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ANTXR2 c.940G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'APC2 c.1312C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'APLP1 c.1243C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ARF6 c.352_354delCTC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ARHGAP6 c.1585G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ARHGEF1 c.2031_2033delGCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ARHGEF19 c.1379C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ARHGEF7 c.2072G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ARL10 c.53C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ARL6IP4 c.902_904delAGA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ARRDC4 c.227C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ARSI c.312G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ASCC3 c.5962A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ASH1L c.8522G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ASPRV1 c.985G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ATM c.3403-4dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ATP13A2 c.2984C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ATP2C2 c.2192delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ATP6AP1 c.508A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ATP7A c.3388C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ATRN c.263_268delCGGCGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'B3GLCT c.517G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'B4GALNT2 c.1414G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'B4GALT7 c.431T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'BEGAIN c.1231G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BEST1 c.273C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BET1 c.327dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BNC1 c.86G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BOC c.896G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BPIFB4 c.1146G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BRPF1 c.3069C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BRPF1 c.823G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'BRWD3 c.3188G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'BTBD17 c.106G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C10orf88 c.401dupA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C16orf47 c.329G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C16orf95 c.407G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C17orf100 c.71C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C17orf105 c.97G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'C1QL4 c.185G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C1orf122 c.17G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C1orf168 c.2134G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C3 c.3566_3567delTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'C5orf60 c.770G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'C7orf31 c.931A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CACNA1C c.169G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CACNA1D c.26_28delAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CACNA1D c.58C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CACNA1I c.2939G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CACNA1S c.4718C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CAD c.1429G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CADPS c.1595G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CAPS2 c.158C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CARS2 c.1419C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CATSPERE c.2471A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CC2D1A c.1030C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CC2D2B c.312G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC105 c.895G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC114 c.445G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC142 c.1220G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CCDC168 c.17281G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC22 c.442C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC39 c.1189C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CCDC47 c.21C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CCDC70 c.239G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC73 c.896C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCDC8 c.316G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CCDC91 c.1163C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CCP110 c.2504G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CD3G c.497G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CD80 c.832G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CD9 c.85C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CDC25A c.1517G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CDH13 c.1498G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CDH23 c.691G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CDK18 c.1073G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CDKN2A c.23G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CDX4 c.455G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CEBPZ c.2155T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CELSR3 c.5802delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CELSR3 c.9748C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CENPE c.2797G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CENPE c.4270C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CENPV c.596C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CEP170B c.1955T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CEP170B c.3520C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CEP250 c.589G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CFAP157 c.1441C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CFHR4 c.996C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CGB3 c.427G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CHADL c.868C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CHCHD10 c.227G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CHD2 c.2366G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CHD3 c.1796G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CHD3 c.3880G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CHPF c.2009A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CHRNA5 c.1192G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CHST13 c.716G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CIZ1 c.626G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLCN6 c.698G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLCNKA c.476G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLDN15 c.301C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLEC3A c.547G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLEC4F c.839G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLIP4 c.890G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLSPN c.533G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CLTA c.698G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CLUH c.2743G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CMBL c.460G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CNR1 c.982C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CNTD2 c.164C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'COL11A2 c.3100C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL1A1 c.3680G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL22A1 c.3584G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'COL22A1 c.379C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL27A1 c.2295C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL4A1 c.3263G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL6A2 c.1267C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'COL6A5 c.5543G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CRB2 c.2873G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CREB3L1 c.1267C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CRH c.445G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CRYBG2 c.1418_1419insGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CSMD1 c.1090G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'CST9 c.289C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CT55 c.331A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CTAGE4 c.1963A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CTBP1 c.1130C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CTH c.589C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CTNNB1 c.1517T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CTTNBP2 c.3100G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CX3CL1 c.1130C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'CXCR3 c.386G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CYBA c.437G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CYBB c.1461G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CYGB c.406G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'CYP2F1 c.1028G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DAAM1 c.1015C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DAB2 c.2173C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DACH1 c.1726C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DALRD3 c.896A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DDIAS c.2524G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DEF8 c.1414G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DEFB121 c.154G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DENND1A c.1343G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'DENND2C c.794G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DENND4A c.311G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DFFB c.379G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DGAT1 c.458G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DGKI c.40C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DHRSX c.721G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DNAH10 c.3640G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DNAH9 c.1243C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DNAH9 c.6584A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DOCK1 c.5259G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DOCK11 c.307G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DOCK2 c.543C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'DOCK3 c.2086G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DOCK4 c.5740G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'DOCK8 c.1205C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'DRAM2 c.133G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'EBPL c.20T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ECT2 c.619C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'EFHC2 c.679G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'EFHD1 c.88G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ELMSAN1 c.939dupC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ELOA2 c.1207G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ENC1 c.206G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ENDOG c.142G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ERFE c.467C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'EVC c.1168C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'EVC2 c.2095A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'EVI5 c.1213T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'F8 c.3380G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAAP100 c.22G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FAM135B c.2615G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM160B2 c.305delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM161B c.932G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FAM192A c.634C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FAM210B c.245A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM212A c.216_218delGGA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM219A c.499G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FAM220A c.266C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM50B c.307C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FAM86B2 c.892+5A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FAM89A c.110C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FANCA c.4232C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FASN c.4447G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FASTKD3 c.20G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FBXO3 c.7G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FBXO33 c.101_109delAGCTGCGAC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FBXW10 c.1573G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FBXW12 c.174A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'FBXW9 c.209G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FCF1 c.589C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FDX1L c.494C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FIGNL2 c.856G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FIP1L1 c.1180C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FKBP15 c.3637G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FLG c.5378G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'FLII c.668G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FLNA c.6100C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FMR1 c.1544G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FOXD4 c.748_749delGGinsC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FOXN4 c.455delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FOXO4 c.574C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'FRAS1 c.5732A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FSCN2 c.853G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FSIP2 c.18617_18618delTA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'FSTL1 c.755G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'FUT7 c.49G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GAREM1 c.1673G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'GATAD2B c.1704G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GGCT c.206C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GGT5 c.1334C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GGT7 c.1093G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GJA9 c.595G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GLI2 c.4672G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'GLRA4 c.440C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GLT8D2 c.278G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GMPPB c.887G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GNB1 c.983C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GOLGA2 c.1483C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GOLGA8K c.1702G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'GOLGA8K c.962A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GOLIM4 c.949C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GOLM1 c.179G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GP9 c.131C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPC1 c.1030G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR149 c.1041C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR155 c.1384G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR50 c.514G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR52 c.18G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR6 c.715C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GPR83 c.321C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GPR88 c.568G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GRIA1 c.2318C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GRIA3 c.1913G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GRIA3 c.2431G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GRK7 c.1027G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GRK7 c.146G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'GRN c.266C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GSE1 c.1201G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GSG2 c.611G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GTPBP1 c.1339C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'GUCY2D c.2035G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'GYG2 c.910C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'HCFC1 c.4873G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HCN1 c.808C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HDDC2 c.385G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HDLBP c.1417C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HEPHL1 c.3193G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HES2 c.13C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HGSNAT c.1622C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HINT3 c.10G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HIP1 c.2956G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HIST1H2AL c.186G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HIST2H3D c.19A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HJURP c.520G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HMGA2 c.275C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'HNRNPUL2 c.206G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HOXB9 c.232T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HOXD4 c.121G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HRG c.988G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HUNK c.1708C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HUWE1 c.11869C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'HYAL3 c.428G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'HYDIN c.10541G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ICAM3 c.869G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'IFI30 c.34C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'IFNA10 c.178C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IFT81 c.1313G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IGFN1 c.5179G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}, {'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'IGFN1 c.5683T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-81.1', 'upperLimit': '81.1'}]}]}, {'title': 'IGFN1 c.5695G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}, {'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-81.1', 'upperLimit': '81.1'}]}]}, {'title': 'IGSF9B c.932G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IL12RB1 c.1097C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IL6ST c.1165G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ILF3 c.1480G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'INA c.41_43delCCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ING1 c.361C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'INTS9 c.1412G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IQCH c.310C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IQGAP2 c.4025G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'IQSEC3 c.1468G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ISM2 c.701C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITGA1 c.3334G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITGA9 c.1040C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITGA9 c.433C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITGAE c.1350_1352delGGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ITIH5 c.2035C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITLN2 c.176G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ITPK1 c.625G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'JMJD7 c.889G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'JPH3 c.1412C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'JPH3 c.1688G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'JSRP1 c.548C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KANK3 c.304G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KATNA1 c.443G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KCNAB3 c.689G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KCNE5 c.370C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KCNG1 c.1226C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KCNN4 c.264G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KCNQ4 c.2041G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KDM2A c.1939G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KDM6A c.3068G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIAA0586 c.397C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIAA1109 c.3686C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIAA1324 c.1453G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF13A c.517C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF13B c.5231G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF17 c.1204G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KIF19 c.92C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF1B c.2119A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF1C c.2522C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KIF21B c.4303G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KIR2DS4 c.436A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KLK2 c.259G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KMT2A c.5755G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KMT2B c.265G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KNDC1 c.3065C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KRBA1 c.1058C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'KRTAP17-1 c.125G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KRTAP17-1 c.140G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'KSR1 c.254C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LAMA5 c.104C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LAMA5 c.7771C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'LAMB2 c.2089C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LCE3D c.221G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LDOC1 c.417C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LEMD3 c.1873C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LINC00452 c.718G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LIPN c.748A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LKAAEAR1 c.182G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LMNA c.1634G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LMNA c.356G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LMTK3 c.1696G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LOC100506388 c.217C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LOC441155 c.35dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LOC729159 c.1004_1005delTGinsCA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LPAR2 c.733A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LRP1 c.4006G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LRRC32 c.1573C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LRRC56 c.899G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LRRC59 c.510G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'LRRC8D c.914A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LRRN4 c.421A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LRRN4 c.442C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'LYST c.7192G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'LZTR1 c.1892G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MAD2L2 c.76G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MADD c.2251G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MAEL c.329T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MAGEA10 c.145C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MAGEA5 c.181C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MAGEL2 c.2626G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MAN2A1 c.1916dupA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MANEA c.1096C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MAP7D1 c.2182A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MARCH1 c.11G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MARCH2 c.275G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MAT1A c.280G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MCCC1 c.667G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MCM6 c.1693C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MED12L c.5813C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MED23 c.2836C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MIB2 c.208C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MIER2 c.1453A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MIGA2 c.508G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MIPEP c.1678C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MLIP c.1145C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MMAB c.733G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MMP16 c.391C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MMP24 c.119_121delTGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MNT c.362C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MOV10L1 c.2459A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MRE11 c.1532delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MRGPRE c.47G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MRGPRX4 c.69C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MROH8 c.598G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MST1R c.931delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MTRNR2L3 c.2T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MUC12 c.9229C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MUC16 c.1031G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MUC19 c.18689G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MUC4 c.7666G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MUC4 c.8866G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MUT c.1532G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MYBPC2 c.3193G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'MYH13 c.1440C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MYH9 c.4049_4051delAGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'MYLK3 c.1105C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'MYO7A c.1091delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NANOS1 c.517G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NBPF8 c.1714C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NCAPG2 c.2617C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NCS1 c.250G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NEO1 c.3193G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NFASC c.1747G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NISCH c.4270C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NKX2-5 c.211G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NLGN4X c.166C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NLRP3 c.226G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NOC2L c.994G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NOMO2 c.976G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NOTCH1 c.1892A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NPHS1 c.3250delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NPTX2 c.979C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NTRK2 c.2272G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NUDT16 c.5C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NUDT7 c.259G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NUDT9 c.480delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NUFIP1 c.1336G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'NUFIP1 c.415A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'NUP210 c.1159C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'OBSCN c.11180G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'OBSL1 c.4294C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'OGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ONECUT2 c.751C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'OPRM1 c.266C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'OR8G5 c.716G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'OSBPL2 c.543delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'OVOL1 c.755C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PACS2 c.2428G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PADI2 c.95C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PALD1 c.1525G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PARD3 c.3457C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PARS2 c.599G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCCB c.372G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCDH9 c.3533C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCDH9 c.923C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCDHAC2 c.389C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCDHB13 c.1966G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PCSK4 c.328C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PCSK5 c.1543A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PDE12 c.806_807delTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PDE1B c.1220C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PDE1C c.1733G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PDGFRA c.1365-4C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PDGFRA c.2645G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PDGFRB c.2183+1G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PDX1 c.172G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PDZRN3 c.2348C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PELP1 c.2285C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PGLYRP2 c.1711C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PHACTR1 c.1248G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PHACTR2 c.1429G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PHF8 c.1499G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PHF8 c.2385C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PHLDB1 c.3146G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PHLPP2 c.2843G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PHOX2B c.811C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PI4KA c.5701G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PID1 c.473C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PIDD1 c.992A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PIEZO1 c.3107G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PIGG c.1087C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PIGG c.2061G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PIN1 c.220C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PITPNC1 c.527G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PKHD1 c.5814G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PLCB1 c.2279G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PLEK2 c.458G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PLEKHA5 c.1070C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PLEKHG1 c.2273G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PLEKHM1 c.2174G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PLK5 c.505C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PLXNB1 c.4699G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PODXL2 c.1217G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'POLR2A c.1492G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'POM121C c.1456A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'POMT1 c.1648C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'POTEF c.505C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'POU3F3 c.259G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'PPEF1 c.735C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PRAMEF11 c.1144A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PREP c.815G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PRR14L c.3470A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PRSS55 c.43G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'PTPRS c.2192C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'PTPRS c.2872C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'QRICH2 c.3259G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'QSOX2 c.994C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'R3HCC1 c.309-1G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RAB21 c.41_43delCGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RAD50 c.1684G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RAD54L2 c.1012A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RALGAPA2 c.1332G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RAPH1 c.1993G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RASAL3 c.2062G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RASAL3 c.2155G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RASGRF2 c.123G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RASGRP4 c.1501G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RB1 c.2359C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RBL1 c.294A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RBM25 c.1438G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RBM43 c.167C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RBMXL3 c.1307G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RBPMS c.50A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RFPL2 c.1018_1021delTTGCinsCTGT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RFPL2 c.970A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RGPD3 c.2468A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RGS20 c.1145C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RIMS4 c.597G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RIMS4 c.730G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RIOK3 c.1010C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RNASEL c.1419A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RNF114 c.680A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RNF123 c.3932C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RNF185 c.254G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RNF185 c.558G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RNF214 c.412G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RNH1 c.433G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RPAP3 c.1011delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RPL18 c.335G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RPL4 c.427C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RPS6KA2 c.1756G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RPS6KB2 c.37G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RRBP1 c.2335G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RTN1 c.1600C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'RTP5 c.281G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'RUNDC1 c.337C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'RXFP2 c.604C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SACS c.2488G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SALL3 c.1837G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SAMHD1 c.405_421delCATTGATACACCTCAAT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SAP30L c.193G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SAPCD1 c.119G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SBSN c.1583A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SCAP c.2892delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SEC14L1 c.1129C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SEC14L4 c.287G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SEC24D c.907G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SH2D3C c.898C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SIGLEC9 c.17_19delTGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SIRPG c.1141G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC22A8 c.583G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC26A4 c.575T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC2A5 c.964G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC2A6 c.961G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC2A8 c.576delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC35F1 c.703G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SLC44A3 c.332A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC5A10 c.1211G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC6A13 c.1341C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLC8A1 c.2011A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SLC8A3 c.2374G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SLIT3 c.182G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SMARCA4 c.4185delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SMARCAD1 c.1637G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SOBP c.1950G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SOGA1 c.1477G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SOST c.278C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SOX18 c.698C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SP140 c.2167G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SP8 c.326G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SPATA31A6 c.1997A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SPATA31E1 c.2987G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SPINK2 c.118A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SPIRE2 c.470_472delAGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SPOCD1 c.3199G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SREBF2 c.85G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SSC4D c.1154C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SSH2 c.2626G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'SSPO c.13487A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SSPO c.1967G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SSTR1 c.121C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'STAC3 c.226_227insGGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'STK26 c.1073C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'STK33 c.1280G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'STK38L c.148G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'STK40 c.1198G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'STT3B c.957T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SUDS3 c.397_399delAAG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'SUSD3 c.428C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SYCP2 c.4180C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SYN2 c.544G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'SYNE2 c.9263G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TACC2 c.2488C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TACC2 c.3196G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TACC3 c.1847C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TAF1D c.281delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TBL1X c.826C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TEKT4 c.824G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TET1 c.5408G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TEX264 c.875G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TFAP2E c.305C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TFRC c.1763G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TGM4 c.937G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'THEMIS2 c.1527_1531delTGTGAinsCGTGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TIGD4 c.373G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TLN1 c.7088C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TMC6 c.2054G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TMCO6 c.464T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TMEM151A c.3G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TMEM165 c.703C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TMEM200B c.338G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TMEM232 c.1045G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TMEM237 c.1159G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TMEM59L c.800G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TMEM63C c.2128C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TMEM70 c.113G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TMEM94 c.859G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TNFSF18 c.355A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TNRC18 c.3076A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TNRC6B c.4934G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TOGARAM1 c.2390A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TOP2B c.1057C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TOP2B c.247G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TPR c.583A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TRDN c.1900G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TRIM61 c.365C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TRIM64B c.377delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TRPV1 c.1753A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TSEN2 c.247C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TSEN2 c.451G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TSEN2 c.506G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'TTK c.1324_1327delTCTA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TTN c.68658G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TTN c.68716C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TTPA c.103G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'TULP4 c.4571C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'TXNRD2 c.1522C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'UBASH3B c.32G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'UBE4A c.2306G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'USP32 c.2804G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'USPL1 c.3256G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'VGLL2 c.794C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'WDFY3 c.1262T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'WDR18 c.1075C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'XKR4 c.1918A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'XPO4 c.238C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'XPO7 c.2398C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZAR1 c.1145C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZC3H12B c.2285G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZC3H12D c.1213C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZC3H7B c.1569C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZC3H8 c.220G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZDBF2 c.5228C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZMPSTE24 c.1085dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZMYM1 c.1965G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZMYM5 c.74C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZMYND15 c.1468G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF10 c.1658C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ZNF207 c.673A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZNF208 c.766T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF276 c.548C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF365 c.307G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ZNF367 c.854G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZNF37A c.1369C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZNF383 c.820C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF420 c.34G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF431 c.1260G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF431 c.1462G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF431 c.1525G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF474 c.757C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ZNF493 c.802G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF536 c.3551A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZNF568 c.1066C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG002', 'lowerLimit': '-56.1', 'upperLimit': '56.1'}]}]}, {'title': 'ZNF680 c.1016A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNF696 c.430C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '33.3', 'groupId': 'OG002', 'lowerLimit': '-41.5', 'upperLimit': '79.2'}]}]}, {'title': 'ZNF782 c.1630G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZNFX1 c.1982C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZP1 c.1103G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ZYX c.697C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '0', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-33.3', 'groupId': 'OG002', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}, {'title': 'ABCA5 c.725_727delCAGinsAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ACSF3 c.1180C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ADAMTS2 c.2243C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ADCK2 c.253C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ADGRA1 c.227G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ADGRF3 c.1615G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ADGRG2 c.1314C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ADGRV1 c.16006C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'AFAP1 c.140A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'AHNAK c.14273A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'AHRR c.1881C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'AKAP13 c.5222C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'AKR1B15 c.452delT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ALS2CR12 c.1079C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ALX3 c.226G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'AMOTL2 c.2426G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ANK3 c.9349dupA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ANKRD33 c.112G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ANXA10 c.655G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'AP4B1 c.1657G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'APPBP2 c.863C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ARHGAP6 c.1393G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ARID1A c.492_494delCGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ARMC12 c.829G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ARSE c.1750C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ATM c.458G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ATM c.6889C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ATP10D c.545G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ATXN7 c.59_61delCGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'BCR c.3055G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'BRIX1 c.494T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'BTG2 c.17G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'C10orf76 c.1715T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'C10orf82 c.343G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'C10orf95 c.581G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'C12orf56 c.989A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'C16orf86 c.922C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'C3 c.641C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CACFD1 c.665_668delCCCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CAMKK2 c.1599_1601delGACinsAACAAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CAPN13 c.1888A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CASKIN2 c.3538A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CASQ2 c.51C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCDC106 c.138G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCDC114 c.601A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CCDC144A c.1001C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCDC168 c.15025G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCDC25 c.137C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCDC93 c.1321G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CCNI2 c.460G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CCNL2 c.532A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CCT3 c.591delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CD1B c.418G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CD7 c.44C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CDH17 c.1315G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CDK6 c.631G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CECR2 c.3651_3655dupAACCC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CELSR1 c.5418G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CEP128 c.3073G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CEP290 c.5517G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CEP85L c.11G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CFAP36 c.685G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CFAP53 c.984_988delGAAACinsAAAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CFAP65 c.2247G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CFAP97 c.481delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CGB3 c.16-2A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CHEK2 c.1409A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CIZ1 c.346C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CLCN1 c.2435_2445delAGCCTGTCTGT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CLCN3 c.1469G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CLDN19 c.503G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CLEC18C c.299T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CLN5 c.272C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CLPTM1L c.1295T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CNOT1 c.4630_4635delCTGTTAinsTTTTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CNTN6 c.2759G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'COL11A2 c.2102C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'COL19A1 c.1703G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'COL27A1 c.1908G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CP c.2291C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CPB2 c.340delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'CRYBG3 c.4646C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'CXCL6 c.86C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CXorf36 c.587G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'CYP11B2 c.1471C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'DCC c.601C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'DEPDC1B c.682G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'DHRS2 c.287A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'DHX29 c.3296C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'DLG5 c.2296G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'DNAAF3 c.976G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'DNAH9 c.6762G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'DOLPP1 c.500A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'DSC2 c.934G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'DST c.4384G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'EML5 c.824G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ENAM c.869G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ENO4 c.1751A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ENPEP c.1552G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'EOGT c.419C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'EPG5 c.6263T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'EREG c.143G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ESRP2 c.381G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'EXOSC10 c.1751C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'F13A1 c.1909-883_2038dup', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'F2RL1 c.280G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FAM186A c.4757_4828delAACTGGGGATCCCTCTCACCCCTCAGC AGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGC GCAGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'FAM193A c.1769C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FAM90A1 c.1261G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'FAM9B c.285G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FANCI c.153C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FARSB c.1177C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'FAT1 c.10630G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FBL c.407C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FGF10 c.365C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FIG4 c.2347G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'FIG4 c.2586A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'FNTA c.408C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FOXRED1 c.104C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FOXRED1 c.65G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'FXR2 c.994A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GAB3 c.1307C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GAGE2A c.175C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GALR2 c.646C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GDF7 c.955C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GFRA1 c.665C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GGT1 c.1081G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GHR c.1705C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GIPR c.301C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GKAP1 c.424G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GKAP1 c.427G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GKAP1 c.432C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GLP1R c.16G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GLYATL2 c.680A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GLYATL2 c.705A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GLYR1 c.1120G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GMNN c.161G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GNRH2 c.40_42delCTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'GOLGA8A c.1463C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GOLGA8A c.1505G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'GOLGA8A c.1538G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'GRIK4 c.2590C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'GRM7 c.2014G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'H2AFY c.10C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'HAUS5 c.425C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HERC1 c.11036G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'HIF3A c.1573C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'HOXA13 c.396_398delCGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'HOXD13 c.120C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HRH1 c.1048C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'HRNR c.7688G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'HSD17B12 c.682C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HSPG2 c.8873C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HUWE1 c.1553C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HUWE1 c.1924G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'HUWE1 c.7633C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ICAM4 c.38dupT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'IGFN1 c.5612A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'IGFN1 c.5624C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'IL12RB1 c.1442G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ILF2 c.40_41delGGinsTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'IQSEC3 c.973G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ITGAD c.2240G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ITPR2 c.8022G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'JKAMP c.158G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'JPH3 c.169A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KIAA0513 c.646G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KIAA0895 c.720C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'KIAA1107 c.3152C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KIAA1107 c.3310C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KIF5C c.226G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KLHL34 c.1513G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KLHL9 c.825T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'KLRK1 c.197G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'KMT5C c.1141dupC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KNL1 c.1800G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'KRT13 c.610G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'KRTAP9-9 c.35_36insACCTGCTGCAGGACC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LCA5L c.1198G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LCAT c.625C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LCT c.1925C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LDB3 c.2012G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LILRB5 c.1274C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LMNA c.1977G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LMO7 c.1315T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LOC100505841 c.50G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LOC101928841 c.3272G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LONRF3 c.712C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LRP2 c.13139dupC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LRRC4 c.912_913delTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LRRC40 c.1457C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'LRRK1 c.644G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'LTBP1 c.307C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MADD c.3458C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MAP2K2 c.1069C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MAZ c.272C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MED21 c.35T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MED23 c.2276dupA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'METTL5 c.388G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MICALL1 c.2475C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MIER3 c.1113delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MMP2 c.1484G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MMP24 c.170_172delCGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MRPL21 c.581G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MRVI1 c.1446delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MUC12 c.13432C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC12 c.2740T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC12 c.4291G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC12 c.5251A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MUC12 c.5512C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC12 c.5575G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC12 c.5612C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC16 c.17447G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MUC19 c.3641G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MUC4 c.3605T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC4 c.7039A>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MUC4 c.8259_10034dup', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MVD c.665G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MX1 c.454G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'MYCBP2 c.1826C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MYCBP2 c.3572C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MYH14 c.2935G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'MYOF c.1772_1773delAG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'MYOM3 c.221C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NALCN c.2063_2065delCCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'NANOGNB c.495_501delGCATAAGinsAAAAAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'NBEA c.5218G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'NCKIPSD c.1430C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'NEB c.17635-2_17635delAGAinsTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NEK1 c.739C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NEPRO c.837delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NEUROD6 c.89A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NFATC1 c.179C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NHS c.2203C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NLRP12 c.2971C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NLRP14 c.3228G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NLRP6 c.176C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NMD3 c.754G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NPHP3 c.1525-4_1526delCTAGTAinsTTTTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'NR2E1 c.592C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NRAP c.4058G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NRG2 c.2084G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NUCB1 c.664C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NUP98 c.2972C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'NYAP2 c.703G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'NYNRIN c.3662G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'OBSCN c.6543G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'OR13C5 c.243_244delGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'OR2T2 c.612_618delCGTGCTG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'OR2T2 c.785T>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'OR2T3 c.611T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'OR2T8 c.590T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'OR2W3 c.337C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'OR4C12 c.222_224delTTC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'OR51A4 c.497_500delGAAAinsCAAG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'OR52D1 c.127G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'OSMR c.937G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'OTOF c.5567G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PADI3 c.1739C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PCDH18 c.809C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PCDH8 c.1583G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PCLO c.2545G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PGLYRP3 c.551G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PGS1 c.1069A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PIGO c.3116delT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PKD1 c.2647C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PLD3 c.464C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'PLK2 c.328G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PLXNA1 c.1114C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PLXND1 c.1393G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PML c.1753delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PODXL2 c.1230delG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'POLQ c.6811C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'POLR2B c.632delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'POM121 c.1916A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'POM121C c.1162_1169delTTTGACTCinsCT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'POTEB2 c.119C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PPP1R12C c.1907C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PPP2R2B c.1196G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PRAMEF2 c.280C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PRKDC c.2601C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PROSER1 c.1587G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PRR19 c.355C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'PRRT3 c.543G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PRSS56 c.1646G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'PTPN13 c.4093G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'R3HDM2 c.79_80delAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RABGEF1 c.854C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'RAD50 c.2165delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'RAP2B c.56T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RASGEF1A c.1062delC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RBM15 c.1231G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'RBMX c.217-2_217-1delAGinsTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'RD3 c.292C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'RGPD1 c.4329A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'RGS17 c.55C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RIMBP2 c.2627C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RLBP1 c.307C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RNF128 c.103G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'RRN3 c.337A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'RSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'RSPH3 c.1186G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'RTTN c.5365G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'S100A7 c.139T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'SAMD13 c.169G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SCML2 c.654G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SCN1A c.1363C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'SCN7A c.2098G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SCRIB c.4063C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'SDK1 c.1769C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SDK2 c.4706C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SEC24A c.2346C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SEMA6D c.509C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SESN1 c.1469G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SFT2D3 c.314C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SHANK1 c.1329G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SHANK1 c.1366G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SHROOM2 c.2815C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SIX3 c.406_407delGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC30A10 c.1408C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SPTBN5 c.2405G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SPTLC1 c.1110C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ST7 c.1658G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'STARD9 c.1654C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'STK32A c.326G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'STRBP c.709C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'SVIL c.2083G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SYNE1 c.23551A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'SYNGR1 c.34G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'TACC2 c.798G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TCF7L1 c.40_42delGGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'TCTN2 c.127G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TEX30 c.132_133delTC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TFCP2L1 c.161C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TM4SF1 c.199T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TMEM202 c.603C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TMEM26 c.709G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TMEM72 c.490G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TMOD3 c.151C>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TMPO c.514A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TMPRSS6 c.435C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SKP1 c.21G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC25A12 c.887C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC2A11 c.995C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC35F2 c.448G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC38A2 c.549T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'SLC39A6 c.1088C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC5A2 c.236G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLC7A14 c.1963T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'SLC7A9 c.887G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SLU7 c.576delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'SOAT1 c.1421T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'SOCS6 c.781G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SORBS1 c.3400G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SP140 c.205G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SPATA31E1 c.2651G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'SPPL2B c.634G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TMPRSS6 c.943G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TNFAIP2 c.512_514delCGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'TNXB c.8806G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TOGARAM2 c.2090C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TOP3B c.2299T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'TRIM17 c.232C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TRIM28 c.335G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TRIM3 c.2235G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TRIO c.9289G>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TRIP12 c.1099C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TSHZ1 c.1204G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TSPEAR c.59C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'TSSC4 c.538G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'TVP23A c.271T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'UBD c.3G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'UBE2O c.1813G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'UGDH c.1294delA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'UGGT2 c.3474-467_3480del', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'URI1 c.49G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'USP28 c.2845C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'USP34 c.1142C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'UTF1 c.302C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'VSTM2B c.457G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'VSTM2B c.603C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'WASHC2C c.1562A>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'WASHC2C c.691G>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'WDR33 c.160C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'WFS1 c.577_579delAAG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'WISP1 c.580A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'WWC1 c.2972T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'YBX3 c.40_42delACC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZFPM1 c.2596C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ZNF148 c.2380_2383delGGCTinsAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZNF185 c.1222G>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ZNF221 c.335C>T', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZNF354C c.1060A>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZNF366 c.1475T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ZNF41 c.1700_1702delAAA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ZNF521 c.3122T>C', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ZNF550 c.157C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ZNF552 c.524_525dupGG', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZNF552 c.533T>G', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}, {'title': 'ZNF628 c.794C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '-50.0', 'groupId': 'OG003', 'lowerLimit': '-90.5', 'upperLimit': '48.6'}]}]}, {'title': 'ZNF883 c.664C>A', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG003', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}, {'title': 'ZSWIM6 c.82_84dupAGC', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '0', 'groupId': 'OG001'}, {'value': '0', 'groupId': 'OG002'}, {'value': '2', 'groupId': 'OG003'}]}], 'categories': [{'measurements': [{'value': '50.0', 'groupId': 'OG003', 'lowerLimit': '-48.6', 'upperLimit': '90.5'}]}]}], 'paramType': 'NUMBER', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.', 'unitOfMeasure': 'Percentage of Participants', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': 'Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.'}, {'type': 'SECONDARY', 'title': 'Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort', 'denoms': [{'units': 'Participants', 'counts': [{'value': '1', 'groupId': 'OG000'}, {'value': '4', 'groupId': 'OG001'}, {'value': '5', 'groupId': 'OG002'}, {'value': '11', 'groupId': 'OG003'}, {'value': '5', 'groupId': 'OG004'}, {'value': '11', 'groupId': 'OG005'}, {'value': '1', 'groupId': 'OG006'}]}], 'groups': [{'id': 'OG000', 'title': 'Cohort 1: NSCLC Monotherapy', 'description': 'Progressive disease on 1st line monotherapy anti-PD-1/-L1.'}, {'id': 'OG001', 'title': 'Cohort 2: NSCLC Combination', 'description': 'Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.'}, {'id': 'OG002', 'title': 'Cohort 3: RCC With Clear Cell Component', 'description': 'Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.'}, {'id': 'OG003', 'title': 'Cohort 4: HR+ HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}, {'id': 'OG004', 'title': 'Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on enzalutamide monotherapy.'}, {'id': 'OG005', 'title': 'Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on abiraterone in combination with prednisone.'}, {'id': 'OG006', 'title': 'Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.'}], 'classes': [{'title': 'Safety Analysis (SA)', 'categories': [{'measurements': [{'value': '1', 'groupId': 'OG000'}, {'value': '4', 'groupId': 'OG001'}, {'value': '5', 'groupId': 'OG002'}, {'value': '10', 'groupId': 'OG003'}, {'value': '5', 'groupId': 'OG004'}, {'value': '10', 'groupId': 'OG005'}, {'value': '1', 'groupId': 'OG006'}]}]}, {'title': 'Biomarker Evaluable (BE)', 'categories': [{'measurements': [{'value': '1', 'groupId': 'OG000'}, {'value': '4', 'groupId': 'OG001'}, {'value': '5', 'groupId': 'OG002'}, {'value': '8', 'groupId': 'OG003'}, {'value': '5', 'groupId': 'OG004'}, {'value': '8', 'groupId': 'OG005'}, {'value': '1', 'groupId': 'OG006'}]}]}, {'title': 'Biomarker Evaluable Target (BET)', 'categories': [{'measurements': [{'value': '0', 'groupId': 'OG000'}, {'value': '1', 'groupId': 'OG001'}, {'value': '3', 'groupId': 'OG002'}, {'value': '6', 'groupId': 'OG003'}, {'value': '4', 'groupId': 'OG004'}, {'value': '2', 'groupId': 'OG005'}, {'value': '1', 'groupId': 'OG006'}]}]}, {'title': 'Fully Biomarker Evaluable (FBE)', 'categories': [{'measurements': [{'value': '0', 'groupId': 'OG000'}, {'value': '1', 'groupId': 'OG001'}, {'value': '1', 'groupId': 'OG002'}, {'value': '1', 'groupId': 'OG003'}, {'value': '1', 'groupId': 'OG004'}, {'value': '0', 'groupId': 'OG005'}, {'value': '0', 'groupId': 'OG006'}]}]}], 'paramType': 'COUNT_OF_PARTICIPANTS', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study', 'unitOfMeasure': 'Participants', 'reportingStatus': 'POSTED', 'populationDescription': 'Participants included in the Safety Analysis population in 7 cohorts.'}, {'type': 'SECONDARY', 'title': 'Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results', 'denoms': [{'units': 'Participants', 'counts': [{'value': '8', 'groupId': 'OG000'}, {'value': '10', 'groupId': 'OG001'}]}], 'groups': [{'id': 'OG000', 'title': 'HR+HER2-adenocarcinoma of the Breast (Cohort 4)', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}, {'id': 'OG001', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}], 'classes': [{'categories': [{'measurements': [{'value': '11.9', 'groupId': 'OG000', 'lowerLimit': '0.0', 'upperLimit': '18.8'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '0.0', 'upperLimit': '16.7'}]}]}], 'paramType': 'MEDIAN', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.', 'unitOfMeasure': 'Percentage of agreed gene alterations', 'dispersionType': 'Full Range', 'reportingStatus': 'POSTED', 'populationDescription': 'Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.'}, {'type': 'SECONDARY', 'title': 'Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '3', 'groupId': 'OG001'}]}], 'groups': [{'id': 'OG000', 'title': 'HR+HER2-adenocarcinoma of the Breast in the BET Populations (Cohort 4)', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}, {'id': 'OG001', 'title': 'HR+HER2-adenocarcinoma of the Breast in the BET (WETD) Populations (Cohort 4)', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}], 'classes': [{'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '-33.3', 'groupId': 'OG001', 'lowerLimit': '-79.2', 'upperLimit': '41.5'}]}]}], 'paramType': 'NUMBER', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle.\n\nCalculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).', 'unitOfMeasure': 'Percentage of participants', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': 'The BET population was participants in the BE population who had a targeted tumor DNA panel biomarker result from both archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all participants in the BET population who had results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. RB1 Gene Alterations analysis was only conducted for Cohort 4 as per protocol.'}, {'type': 'SECONDARY', 'title': 'Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '8', 'groupId': 'OG000'}]}], 'groups': [{'id': 'OG000', 'title': 'HR+HER2-adenocarcinoma of the Breast in the BE (TBD) Populations (Cohort 4)', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}], 'classes': [{'title': 'c.151G>T', 'categories': [{'measurements': [{'value': '12.5', 'groupId': 'OG000', 'lowerLimit': '2.2', 'upperLimit': '47.1'}]}]}, {'title': 'c.184C>T', 'categories': [{'measurements': [{'value': '12.5', 'groupId': 'OG000', 'lowerLimit': '2.2', 'upperLimit': '47.1'}]}]}, {'title': 'c.54_79delGGAACCCCCGGCACCGCCGCCGCCGC', 'categories': [{'measurements': [{'value': '12.5', 'groupId': 'OG000', 'lowerLimit': '2.2', 'upperLimit': '47.1'}]}]}], 'paramType': 'NUMBER', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.', 'unitOfMeasure': 'Percentage of participants', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': 'BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.'}, {'type': 'SECONDARY', 'title': 'Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples', 'denoms': [{'units': 'Participants', 'counts': [{'value': '6', 'groupId': 'OG000'}, {'value': '2', 'groupId': 'OG001'}]}], 'groups': [{'id': 'OG000', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate in the BET Populations (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}, {'id': 'OG001', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate in the BET (WETD) Populations (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}], 'classes': [{'categories': [{'measurements': [{'value': '0.0', 'groupId': 'OG000', 'lowerLimit': '-39.0', 'upperLimit': '39.0'}, {'value': '0.0', 'groupId': 'OG001', 'lowerLimit': '-65.8', 'upperLimit': '65.8'}]}]}], 'paramType': 'NUMBER', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies.\n\nCalculation of change in frequency was described for in the primary endpoint (Outcome Measure 1).\n\nAR gene Alterations analysis was only conducted for the Cohorts 5 \\& 6 as per protocol.', 'unitOfMeasure': 'percentage of participants', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': "The BET and BET (WETD) population was participants in the BE population who have a targeted tumor DNA panel biomarker result, and all participants in the BET population who have results of WETD NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements."}, {'type': 'SECONDARY', 'title': 'Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA', 'denoms': [{'units': 'Participants', 'counts': [{'value': '10', 'groupId': 'OG000'}]}], 'groups': [{'id': 'OG000', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate in the BE (TBD) Populations (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}], 'classes': [{'title': 'c.2105T>A', 'categories': [{'measurements': [{'value': '20.0', 'groupId': 'OG000', 'lowerLimit': '5.7', 'upperLimit': '51.0'}]}]}, {'title': 'c.2202G>C', 'categories': [{'measurements': [{'value': '10.0', 'groupId': 'OG000', 'lowerLimit': '1.8', 'upperLimit': '40.4'}]}]}, {'title': 'c.2632A>G', 'categories': [{'measurements': [{'value': '10.0', 'groupId': 'OG000', 'lowerLimit': '1.8', 'upperLimit': '40.4'}]}]}], 'paramType': 'NUMBER', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone.\n\nPercentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 \\&6.', 'unitOfMeasure': 'Percentage of participants', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': 'BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.'}, {'type': 'SECONDARY', 'title': 'Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'groups': [{'id': 'OG000', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate in the BET (TTR) Populations (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}, {'id': 'OG001', 'title': 'Castrate-resistant Adenocarcinoma of the Prostate in the BET (WTTR) Populations (Cohort 5 & 6)', 'description': 'Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.'}], 'classes': [{'title': 'ESR1', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '0.3', 'groupId': 'OG000', 'lowerLimit': '-16.4', 'upperLimit': '17.1'}, {'value': '25.6', 'groupId': 'OG001', 'lowerLimit': '-11.2', 'upperLimit': '62.5'}]}]}, {'title': 'ESR2', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '-0.4', 'groupId': 'OG000', 'lowerLimit': '-6.3', 'upperLimit': '5.5'}, {'value': '-1.1', 'groupId': 'OG001', 'lowerLimit': '-2.3', 'upperLimit': '0.1'}]}]}, {'title': 'NR3C1', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '0.5', 'groupId': 'OG000', 'lowerLimit': '-1.2', 'upperLimit': '2.1'}, {'value': '5.4', 'groupId': 'OG001', 'lowerLimit': '-30.7', 'upperLimit': '41.5'}]}]}, {'title': 'NR3C2', 'denoms': [{'units': 'Participants', 'counts': [{'value': '0', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '3.7', 'groupId': 'OG001', 'lowerLimit': '-18.2', 'upperLimit': '25.6'}]}]}, {'title': 'PGR', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '-0.5', 'groupId': 'OG000', 'lowerLimit': '-13.4', 'upperLimit': '12.4'}, {'value': '2.0', 'groupId': 'OG001', 'lowerLimit': '-3.9', 'upperLimit': '7.9'}]}]}, {'title': 'AR', 'denoms': [{'units': 'Participants', 'counts': [{'value': '2', 'groupId': 'OG000'}, {'value': '6', 'groupId': 'OG001'}]}], 'categories': [{'measurements': [{'value': '-0.7', 'groupId': 'OG000', 'lowerLimit': '-10.9', 'upperLimit': '9.4'}, {'value': '549.9', 'groupId': 'OG001', 'lowerLimit': '-480.1', 'upperLimit': '1579.9'}]}]}], 'paramType': 'MEAN', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \\[targeted tumor RNA (TTR)\\] population and Tempus RNAseq in BET \\[whole transcriptome tumor RNA (WTTR)\\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 \\& 6 as per protocol.', 'unitOfMeasure': 'normalized expression counts', 'dispersionType': '95% Confidence Interval', 'reportingStatus': 'POSTED', 'populationDescription': "BET (TTR) and BET (WTTR) population was all participants in the BET population who have results of TTR sample analysis, and all participants in the BET population who have results of WTTR NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements."}]}, 'participantFlowModule': {'groups': [{'id': 'FG000', 'title': 'Cohort 1: Non-small Cell Lung Carcinoma (NSCLC) Monotherapy', 'description': 'Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1).'}, {'id': 'FG001', 'title': 'Cohort 2: NSCLC Combination', 'description': 'Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.'}, {'id': 'FG002', 'title': 'Cohort 3: Renal Cell Carcinoma (RCC) With Clear Cell Component', 'description': 'Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.'}, {'id': 'FG003', 'title': 'Cohort 4: Hormone Receptor+Human Epidermal Growth Factor Receptor 2 - Adenocarcinoma of the Breast', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}, {'id': 'FG004', 'title': 'Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on enzalutamide monotherapy.'}, {'id': 'FG005', 'title': 'Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on abiraterone in combination with prednisone.'}, {'id': 'FG006', 'title': 'Cohort 7: Germline Mutated BRCA (gBRCAm) HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.'}], 'periods': [{'title': 'Overall Study', 'milestones': [{'type': 'STARTED', 'achievements': [{'groupId': 'FG000', 'numSubjects': '1'}, {'groupId': 'FG001', 'numSubjects': '4'}, {'groupId': 'FG002', 'numSubjects': '5'}, {'groupId': 'FG003', 'numSubjects': '11'}, {'groupId': 'FG004', 'numSubjects': '5'}, {'groupId': 'FG005', 'numSubjects': '11'}, {'groupId': 'FG006', 'numSubjects': '1'}]}, {'type': 'COMPLETED', 'achievements': [{'groupId': 'FG000', 'numSubjects': '1'}, {'groupId': 'FG001', 'numSubjects': '4'}, {'groupId': 'FG002', 'numSubjects': '5'}, {'comment': '11 participants were enrolled in cohort 4 and only 10 were included in the SA population.', 'groupId': 'FG003', 'numSubjects': '10'}, {'groupId': 'FG004', 'numSubjects': '5'}, {'comment': '11 participants were enrolled in cohort 6 and only 10 were included in the SA population.', 'groupId': 'FG005', 'numSubjects': '10'}, {'groupId': 'FG006', 'numSubjects': '1'}]}, {'type': 'NOT COMPLETED', 'achievements': [{'groupId': 'FG000', 'numSubjects': '0'}, {'groupId': 'FG001', 'numSubjects': '0'}, {'groupId': 'FG002', 'numSubjects': '0'}, {'groupId': 'FG003', 'numSubjects': '1'}, {'groupId': 'FG004', 'numSubjects': '0'}, {'groupId': 'FG005', 'numSubjects': '1'}, {'groupId': 'FG006', 'numSubjects': '0'}]}], 'dropWithdraws': [{'type': 'neither a de novo biopsy nor a research blood draw', 'reasons': [{'groupId': 'FG000', 'numSubjects': '0'}, {'groupId': 'FG001', 'numSubjects': '0'}, {'groupId': 'FG002', 'numSubjects': '0'}, {'groupId': 'FG003', 'numSubjects': '1'}, {'groupId': 'FG004', 'numSubjects': '0'}, {'groupId': 'FG005', 'numSubjects': '1'}, {'groupId': 'FG006', 'numSubjects': '0'}]}]}], 'preAssignmentDetails': 'A total of 38 participants were enrolled into 7 cohorts. The Safety Analysis (SA) population included 36 participants who had de novo biopsy or research blood draw performed.'}, 'baselineCharacteristicsModule': {'denoms': [{'units': 'Participants', 'counts': [{'value': '1', 'groupId': 'BG000'}, {'value': '4', 'groupId': 'BG001'}, {'value': '5', 'groupId': 'BG002'}, {'value': '10', 'groupId': 'BG003'}, {'value': '5', 'groupId': 'BG004'}, {'value': '10', 'groupId': 'BG005'}, {'value': '1', 'groupId': 'BG006'}, {'value': '36', 'groupId': 'BG007'}]}], 'groups': [{'id': 'BG000', 'title': 'Cohort 1: NSCLC Monotherapy', 'description': 'Progressive disease on 1st line monotherapy anti-PD-1/-L1.'}, {'id': 'BG001', 'title': 'Cohort 2: NSCLC Combination', 'description': 'Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.'}, {'id': 'BG002', 'title': 'Cohort 3: RCC With Clear Cell Component', 'description': 'Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.'}, {'id': 'BG003', 'title': 'Cohort 4: HR+ HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.'}, {'id': 'BG004', 'title': 'Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on enzalutamide monotherapy.'}, {'id': 'BG005', 'title': 'Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate', 'description': 'Progressive disease on abiraterone in combination with prednisone.'}, {'id': 'BG006', 'title': 'Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast', 'description': 'Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.'}, {'id': 'BG007', 'title': 'Total', 'description': 'Total of all reporting groups'}], 'measures': [{'title': 'Age, Continuous', 'classes': [{'categories': [{'measurements': [{'value': '73.0', 'groupId': 'BG000'}, {'value': '70.8', 'spread': '6.90', 'groupId': 'BG001'}, {'value': '65.0', 'spread': '9.11', 'groupId': 'BG002'}, {'value': '66.6', 'spread': '6.88', 'groupId': 'BG003'}, {'value': '76.0', 'spread': '9.85', 'groupId': 'BG004'}, {'value': '64.7', 'spread': '6.62', 'groupId': 'BG005'}, {'value': '43.0', 'groupId': 'BG006'}, {'value': '67.1', 'spread': '8.99', 'groupId': 'BG007'}]}]}], 'paramType': 'MEAN', 'description': 'Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population', 'unitOfMeasure': 'Years', 'dispersionType': 'STANDARD_DEVIATION'}, {'title': 'Sex: Female, Male', 'classes': [{'categories': [{'title': 'Female', 'measurements': [{'value': '0', 'groupId': 'BG000'}, {'value': '0', 'groupId': 'BG001'}, {'value': '1', 'groupId': 'BG002'}, {'value': '10', 'groupId': 'BG003'}, {'value': '0', 'groupId': 'BG004'}, {'value': '0', 'groupId': 'BG005'}, {'value': '1', 'groupId': 'BG006'}, {'value': '12', 'groupId': 'BG007'}]}, {'title': 'Male', 'measurements': [{'value': '1', 'groupId': 'BG000'}, {'value': '4', 'groupId': 'BG001'}, {'value': '4', 'groupId': 'BG002'}, {'value': '0', 'groupId': 'BG003'}, {'value': '5', 'groupId': 'BG004'}, {'value': '10', 'groupId': 'BG005'}, {'value': '0', 'groupId': 'BG006'}, {'value': '24', 'groupId': 'BG007'}]}]}], 'paramType': 'COUNT_OF_PARTICIPANTS', 'description': 'Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population', 'unitOfMeasure': 'Participants'}, {'title': 'Ethnicity (NIH/OMB)', 'classes': [{'categories': [{'title': 'Hispanic or Latino', 'measurements': [{'value': '1', 'groupId': 'BG000'}, {'value': '0', 'groupId': 'BG001'}, {'value': '1', 'groupId': 'BG002'}, {'value': '3', 'groupId': 'BG003'}, {'value': '1', 'groupId': 'BG004'}, {'value': '0', 'groupId': 'BG005'}, {'value': '0', 'groupId': 'BG006'}, {'value': '6', 'groupId': 'BG007'}]}, {'title': 'Not Hispanic or Latino', 'measurements': [{'value': '0', 'groupId': 'BG000'}, {'value': '3', 'groupId': 'BG001'}, {'value': '3', 'groupId': 'BG002'}, {'value': '6', 'groupId': 'BG003'}, {'value': '3', 'groupId': 'BG004'}, {'value': '3', 'groupId': 'BG005'}, {'value': '0', 'groupId': 'BG006'}, {'value': '18', 'groupId': 'BG007'}]}, {'title': 'Unknown or Not Reported', 'measurements': [{'value': '0', 'groupId': 'BG000'}, {'value': '1', 'groupId': 'BG001'}, {'value': '1', 'groupId': 'BG002'}, {'value': '1', 'groupId': 'BG003'}, {'value': '1', 'groupId': 'BG004'}, {'value': '7', 'groupId': 'BG005'}, {'value': '1', 'groupId': 'BG006'}, {'value': '12', 'groupId': 'BG007'}]}]}], 'paramType': 'COUNT_OF_PARTICIPANTS', 'description': 'Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population', 'unitOfMeasure': 'Participants'}, {'title': 'Race/Ethnicity, Customized', 'classes': [{'categories': [{'title': 'White', 'measurements': [{'value': '1', 'groupId': 'BG000'}, {'value': '4', 'groupId': 'BG001'}, {'value': '3', 'groupId': 'BG002'}, {'value': '10', 'groupId': 'BG003'}, {'value': '4', 'groupId': 'BG004'}, {'value': '6', 'groupId': 'BG005'}, {'value': '0', 'groupId': 'BG006'}, {'value': '28', 'groupId': 'BG007'}]}, {'title': 'Multiracial', 'measurements': [{'value': '0', 'groupId': 'BG000'}, {'value': '0', 'groupId': 'BG001'}, {'value': '1', 'groupId': 'BG002'}, {'value': '0', 'groupId': 'BG003'}, {'value': '0', 'groupId': 'BG004'}, {'value': '0', 'groupId': 'BG005'}, {'value': '0', 'groupId': 'BG006'}, {'value': '1', 'groupId': 'BG007'}]}, {'title': 'Not reported', 'measurements': [{'value': '0', 'groupId': 'BG000'}, {'value': '0', 'groupId': 'BG001'}, {'value': '1', 'groupId': 'BG002'}, {'value': '0', 'groupId': 'BG003'}, {'value': '1', 'groupId': 'BG004'}, {'value': '4', 'groupId': 'BG005'}, {'value': '1', 'groupId': 'BG006'}, {'value': '7', 'groupId': 'BG007'}]}]}], 'paramType': 'COUNT_OF_PARTICIPANTS', 'description': 'Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population', 'unitOfMeasure': 'Participants'}]}}, 'documentSection': {'largeDocumentModule': {'largeDocs': [{'date': '2020-05-12', 'size': 4517847, 'label': 'Study Protocol', 'hasIcf': False, 'hasSap': False, 'filename': 'Prot_000.pdf', 'typeAbbrev': 'Prot', 'uploadDate': '2021-11-29T18:43', 'hasProtocol': True}, {'date': '2020-06-02', 'size': 2959896, 'label': 'Statistical Analysis Plan', 'hasIcf': False, 'hasSap': True, 'filename': 'SAP_001.pdf', 'typeAbbrev': 'SAP', 'uploadDate': '2021-11-29T18:43', 'hasProtocol': False}]}}, 'protocolSection': {'designModule': {'phases': ['NA'], 'studyType': 'INTERVENTIONAL', 'designInfo': {'allocation': 'NA', 'maskingInfo': {'masking': 'NONE'}, 'primaryPurpose': 'OTHER', 'interventionModel': 'SINGLE_GROUP'}, 'enrollmentInfo': {'type': 'ACTUAL', 'count': 38}}, 'statusModule': {'whyStopped': 'Study terminated due to lack of enrollment that has been compounded by the global COVID-19 pandemic. There were no safety and/or efficacy concerns involved in the decision to stop enrollment.', 'overallStatus': 'TERMINATED', 'startDateStruct': {'date': '2019-02-13', 'type': 'ACTUAL'}, 'expandedAccessInfo': {'hasExpandedAccess': False}, 'statusVerifiedDate': '2024-11', 'completionDateStruct': {'date': '2020-12-14', 'type': 'ACTUAL'}, 'lastUpdateSubmitDate': '2024-11-25', 'studyFirstSubmitDate': '2020-06-09', 'resultsFirstSubmitDate': '2021-11-29', 'studyFirstSubmitQcDate': '2020-06-16', 'lastUpdatePostDateStruct': {'date': '2024-12-03', 'type': 'ACTUAL'}, 'resultsFirstSubmitQcDate': '2024-11-25', 'studyFirstPostDateStruct': {'date': '2020-06-17', 'type': 'ACTUAL'}, 'resultsFirstPostDateStruct': {'date': '2024-12-03', 'type': 'ACTUAL'}, 'primaryCompletionDateStruct': {'date': '2020-12-14', 'type': 'ACTUAL'}}, 'outcomesModule': {'primaryOutcomes': [{'measure': 'Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.'}], 'secondaryOutcomes': [{'measure': 'Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study'}, {'measure': 'Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.'}, {'measure': 'Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle.\n\nCalculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).'}, {'measure': 'Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.'}, {'measure': 'Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies.\n\nCalculation of change in frequency was described for in the primary endpoint (Outcome Measure 1).\n\nAR gene Alterations analysis was only conducted for the Cohorts 5 \\& 6 as per protocol.'}, {'measure': 'Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone.\n\nPercentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 \\&6.'}, {'measure': 'Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples', 'timeFrame': 'Through study completion, approximately 3 months', 'description': 'The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \\[targeted tumor RNA (TTR)\\] population and Tempus RNAseq in BET \\[whole transcriptome tumor RNA (WTTR)\\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 \\& 6 as per protocol.'}]}, 'oversightModule': {'isFdaRegulatedDrug': False, 'isFdaRegulatedDevice': False}, 'conditionsModule': {'keywords': ['Non Small Cell Lung Cancer', 'Renal Cell Carcinoma', 'HR+ HER2- Breast Cancer', 'Castrate-Resistant Prostate Cancer', 'Germline mutated BRCA, HER2- Breast Cancer'], 'conditions': ['Disease Progression']}, 'referencesModule': {'seeAlsoLinks': [{'url': 'https://pmiform.com/clinical-trial-info-request?StudyID=A9001502', 'label': 'To obtain contact information for a study center near you, click here.'}]}, 'descriptionModule': {'briefSummary': 'The TRANSLATE study aims to better understand why tumors become resistant to standard anti-cancer therapies.\n\nNew tumor biopsy and blood samples are collected after disease progression on standard-of-care anti-cancer treatment and compared to the initial (archival) tumor biopsy sample taken from the same patient.\n\nAnnotated reports of results from clinical Next Generation Sequencing (NGS) gene panel tests of both tumor and blood are sent directly from the testing lab to the study physician for discussion with the patient during the study.\n\nPatients may participate in interventional treatment clinical trials at the same time as participating in the TRANSLATE study.\n\nPrimary data will be publicly available after the study to support further research.', 'detailedDescription': 'Background: Development of new cancer treatments requires better understanding of why tumors develop resistance to standard-of-care (SOC) therapies. However, post-progression tumor biopsies are not routinely collected, limiting the tissue available to characterize mechanisms of treatment resistance. The TRANSLATE clinical study is specifically designed to address these critical gaps.\n\nTrial design: TRANSLATE is a global, multicenter, translational study designed to collect and compare archival pre-treatment tumor tissue with paired de novo tumor and blood samples obtained following disease progression on SOC therapies, targeting therapeutically important areas of cancer biology.\n\nEligible Tumor Type and Most Recent SOC Therapy:\n\n* Non-small-cell lung and Anti-PD-1/-L1 monotherapy\n* Non-small-cell lung and Anti-PD-1/-L1 + platinum\n* Clear cell renal cell carcinoma and Anti-PD-1/-L1 monotherapy\n* Clear cell renal cell carcinoma and Doublet anti-PD-1/-L1 + anti-CTLA-4\n* Clear cell renal cell carcinoma and Pembrolizumab + axitinib\n* Clear cell renal cell carcinoma and Avelumab + axitinib\n* HR+ HER2- breast and Palbociclib + hormonal therapy\n* germline mutated BRCA breast and Olaparib or talazoparib monotherapy\n* Castration-resistant prostate and Enzalutamide\n* Castration-resistant prostate and Abiraterone + prednisone\n\nEligibility criteria include adults with locally advanced or metastatic tumors; radiographic evidence of progressive disease during the most recent SOC regimen; sufficient archival tumor tissue; and a post-progression tumor lesion that is safely accessible for a new biopsy.\n\nThe results from clinical NGS panel testing may help inform subsequent treatment plan or identification of relevant interventional clinical trials.\n\nPatients are enrolled after disease progression on SOC and before change in treatment and participate in 3 study visits within approximately 3 months.\n\nNext-generation sequencing results from analysis of tumor tissue and blood will be returned to the study physician and patient for review at a subsequent study visit within this timeframe.\n\nThe primary endpoint is the change in frequency of gene alterations between pre-treatment and post-progression tumor biopsies. Secondary endpoints address prioritized scientific hypotheses specific to each target area of biology and indication.\n\nPrimary data will be publicly available after the study to support further research.\n\nSponsored by Pfizer Inc.; EudraCT: 2018-003612-45.'}, 'eligibilityModule': {'sex': 'ALL', 'stdAges': ['ADULT', 'OLDER_ADULT'], 'minimumAge': '18 Years', 'healthyVolunteers': False, 'eligibilityCriteria': 'Inclusion Criteria:\n\n* Histological diagnosis of locally advanced (primary or recurrent) or metastatic solid tumors treated as follows:\n* Non small cell lung carcinoma (NSCLC) monotherapy: Disease progression (PD) on 1st line monotherapy anti PD-1/ L1.\n* NSCLC combination: PD on 1st line anti PD-1/ L1 plus standard doublet platinum containing regimen; or PD on 1st-line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1).\n* Renal cell carcinoma (RCC) with clear cell component: PD on 2nd line monotherapy anti PD-1/ L1; or PD on 1st line combination of doublet anti-PD-1/ L1 with anti-CTLA-4; or PD on 1st-line combination of avelumab with axitinib or pembrolizumab with axitinib.\n* HR+ HER2 adenocarcinoma of the breast: PD on 1st line combination of doublet palbociclib with hormonal therapy.\n* Castrate resistant adenocarcinoma of the prostate: PD on enzalutamide monotherapy.\n* Castrate resistant adenocarcinoma of the prostate: PD on abiraterone in combination with prednisone.\n* germline mutated BRCA (gBRCAm), HER2- breast cancer: PD on a PARP inhibitor monotherapy in patients previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.\n* Radiographic evidence of PD, including the target lesion being subjected to biopsy for the study, on the most recent regimen that requires a change in anti-cancer treatment.\n\nExclusion Criteria:\n\n* Tumor biopsy taken from a bone or an irradiated target lesion.\n* Discontinuation of current or most recent anti cancer therapy due to toxicity and not progressive disease.\n* Initiation of new anti-cancer therapy after disease progression prior to planned biopsy.'}, 'identificationModule': {'nctId': 'NCT04436120', 'briefTitle': 'Treatment Resistance Following Anti-cancer Therapies', 'organization': {'class': 'INDUSTRY', 'fullName': 'Pfizer'}, 'officialTitle': 'TREATMENT RESISTANCE FOLLOWING ANTI-CANCER THERAPIES (TRANSLATE)', 'orgStudyIdInfo': {'id': 'A9001502'}, 'secondaryIdInfos': [{'id': 'TRANSLATE', 'type': 'OTHER', 'domain': 'Alias Study Number'}, {'id': '2018-003612-45', 'type': 'EUDRACT_NUMBER'}]}, 'armsInterventionsModule': {'armGroups': [{'type': 'OTHER', 'label': 'Tumor biopsy and blood draw', 'description': 'Tumor biopsy and blood draw', 'interventionNames': ['Procedure: De novo tumor tissue biopsy', 'Procedure: Research blood draws']}], 'interventions': [{'name': 'De novo tumor tissue biopsy', 'type': 'PROCEDURE', 'description': 'De novo tissue biopsy performed following disease progression', 'armGroupLabels': ['Tumor biopsy and blood draw']}, {'name': 'Research blood draws', 'type': 'PROCEDURE', 'description': 'Blood biospecimens collected following disease progression', 'armGroupLabels': ['Tumor biopsy and blood draw']}]}, 'contactsLocationsModule': {'locations': [{'zip': '36526', 'city': 'Daphne', 'state': 'Alabama', 'country': 'United States', 'facility': 'Southern Cancer Center, P.C.', 'geoPoint': {'lat': 30.60353, 'lon': -87.9036}}, {'zip': '36607', 'city': 'Mobile', 'state': 'Alabama', 'country': 'United States', 'facility': 'Southern Cancer Center, PC', 'geoPoint': {'lat': 30.69436, 'lon': -88.04305}}, {'zip': '36608', 'city': 'Mobile', 'state': 'Alabama', 'country': 'United States', 'facility': 'Southern Cancer Center, PC', 'geoPoint': {'lat': 30.69436, 'lon': -88.04305}}, {'zip': '99503', 'city': 'Anchorage', 'state': 'Alaska', 'country': 'United States', 'facility': 'Alaska Urological Institute dba Alaska Clinical Research Center', 'geoPoint': {'lat': 61.21806, 'lon': -149.90028}}, {'zip': '85704', 'city': 'Tucson', 'state': 'Arizona', 'country': 'United States', 'facility': 'Arizona Oncology Associates, PC-HOPE', 'geoPoint': {'lat': 32.22174, 'lon': -110.92648}}, {'zip': '85711', 'city': 'Tucson', 'state': 'Arizona', 'country': 'United States', 'facility': 'Arizona Oncology Associates, PC - HOPE', 'geoPoint': {'lat': 32.22174, 'lon': -110.92648}}, {'zip': '91204', 'city': 'Glendale', 'state': 'California', 'country': 'United States', 'facility': 'The Oncology Institute of Hope Innovation', 'geoPoint': {'lat': 34.14251, 'lon': -118.25508}}, {'zip': '90805', 'city': 'Long Beach', 'state': 'California', 'country': 'United States', 'facility': 'The Oncology Institute of Hope Innovation', 'geoPoint': {'lat': 33.76696, 'lon': -118.18923}}, {'zip': '92868-3201', 'city': 'Orange', 'state': 'California', 'country': 'United States', 'facility': 'UCI Medical Center-Chao Family Comprehensive Cancer Center', 'geoPoint': {'lat': 33.78779, 'lon': -117.85311}}, {'zip': '92705', 'city': 'Santa Ana', 'state': 'California', 'country': 'United States', 'facility': 'The Oncology Institute of Hope Innovation', 'geoPoint': {'lat': 33.74557, 'lon': -117.86783}}, {'zip': '93105', 'city': 'Santa Barbara', 'state': 'California', 'country': 'United States', 'facility': 'Sansum Clinic', 'geoPoint': {'lat': 34.42083, 'lon': -119.69819}}, {'zip': '93463', 'city': 'Solvang', 'state': 'California', 'country': 'United States', 'facility': 'Sansum Clinic', 'geoPoint': {'lat': 34.59582, 'lon': -120.13765}}, {'zip': '90602', 'city': 'Whittier', 'state': 'California', 'country': 'United States', 'facility': 'The Oncology Institute of Hope and Innovation', 'geoPoint': {'lat': 33.97918, 'lon': -118.03284}}, {'zip': '90603', 'city': 'Whittier', 'state': 'California', 'country': 'United States', 'facility': 'ICRI-Administrative and Supplies Only', 'geoPoint': {'lat': 33.97918, 'lon': -118.03284}}, {'zip': '32503', 'city': 'Pensacola', 'state': 'Florida', 'country': 'United States', 'facility': 'Woodlands Medical Specialists PA', 'geoPoint': {'lat': 30.42131, 'lon': -87.21691}}, {'zip': '98109', 'city': 'Seattle', 'state': 'Washington', 'country': 'United States', 'facility': 'Seattle Cancer Care Alliance', 'geoPoint': {'lat': 47.60621, 'lon': -122.33207}}, {'zip': '98195', 'city': 'Seattle', 'state': 'Washington', 'country': 'United States', 'facility': 'University of Washington Medical Center', 'geoPoint': {'lat': 47.60621, 'lon': -122.33207}}, {'zip': '8500', 'city': 'Viedma', 'state': 'Río Negro Province', 'country': 'Argentina', 'facility': 'Clínica Viedma S.A.', 'geoPoint': {'lat': -40.81519, 'lon': -63.0004}}, {'zip': 'S2000ORE', 'city': 'Rosario', 'state': 'Santa Fe Province', 'country': 'Argentina', 'facility': 'Sanatorio de la Mujer', 'geoPoint': {'lat': -32.94682, 'lon': -60.63932}}, {'zip': 'C1280AEB', 'city': 'CABA', 'country': 'Argentina', 'facility': 'Hospital Britanico de Buenos Aires'}, {'zip': 'C1431FWO', 'city': 'Ciudad Autónoma de Bs As', 'country': 'Argentina', 'facility': 'Centro de Educacion Medica e Investigaciones Clinicas"Norberto Quirno" CEMIC'}, {'zip': '6000', 'city': 'Charleroi', 'country': 'Belgium', 'facility': 'Grand Hôpital de Charleroi - Site Notre Dame', 'geoPoint': {'lat': 50.41136, 'lon': 4.44448}}, {'zip': '9000', 'city': 'Ghent', 'country': 'Belgium', 'facility': 'AZ Maria Middelares', 'geoPoint': {'lat': 51.05, 'lon': 3.71667}}, {'zip': '9000', 'city': 'Ghent', 'country': 'Belgium', 'facility': 'UZ Gent', 'geoPoint': {'lat': 51.05, 'lon': 3.71667}}, {'zip': '7100', 'city': 'Haine-Saint-Paul', 'country': 'Belgium', 'facility': 'Hôpital de Jolimont', 'geoPoint': {'lat': 50.45544, 'lon': 4.1885}}, {'zip': '1340', 'city': 'Ottignies', 'country': 'Belgium', 'facility': 'Clinique Saint-Pierre Ottignies', 'geoPoint': {'lat': 50.66535, 'lon': 4.56679}}, {'zip': '63011', 'city': 'Clermont-Ferrand', 'country': 'France', 'facility': 'Centre Jean Perrin', 'geoPoint': {'lat': 45.77969, 'lon': 3.08682}}, {'zip': '68024', 'city': 'Colmar', 'country': 'France', 'facility': 'Hôpitaux Civils de Colmar, Centre Hospitalier Louis Pasteur', 'geoPoint': {'lat': 48.08078, 'lon': 7.35584}}, {'zip': '94010', 'city': 'Créteil', 'country': 'France', 'facility': 'CHU Henri Mondor', 'geoPoint': {'lat': 48.79266, 'lon': 2.46569}}, {'zip': '31130', 'city': 'Quint-Fonsegrives', 'country': 'France', 'facility': 'Hôpital La Croix du Sud', 'geoPoint': {'lat': 43.5852, 'lon': 1.5272}}, {'zip': '51056', 'city': 'Reims', 'country': 'France', 'facility': 'Institut Jean Godinot', 'geoPoint': {'lat': 49.26526, 'lon': 4.02853}}, {'zip': '94160', 'city': 'Saint-Mandé', 'country': 'France', 'facility': 'Hopital Bégin', 'geoPoint': {'lat': 48.83864, 'lon': 2.41579}}, {'zip': 'TR1 3IJ', 'city': 'Cornwall', 'country': 'United Kingdom', 'facility': 'Royal Cornwall Hospital'}], 'overallOfficials': [{'name': 'Pfizer CT.gov Call Center', 'role': 'STUDY_DIRECTOR', 'affiliation': 'Pfizer'}]}, 'ipdSharingStatementModule': {'ipdSharing': 'NO', 'description': "Pfizer will provide access to individual de-identified participant data and related study documents (e.g. protocol, Statistical Analysis Plan (SAP), Clinical Study Report (CSR)) upon request from qualified researchers, and subject to certain criteria, conditions, and exceptions. Further details on Pfizer's data sharing criteria and process for requesting access can be found at: https://www.pfizer.com/science/clinical\\_trials/trial\\_data\\_and\\_results/data\\_requests."}, 'sponsorCollaboratorsModule': {'leadSponsor': {'name': 'Pfizer', 'class': 'INDUSTRY'}, 'responsibleParty': {'type': 'SPONSOR'}}}}