Ignite Creation Date:
2024-05-06 @ 5:11 PM
Last Modification Date:
2024-10-26 @ 2:24 PM
Study NCT ID:
NCT05229822
Status:
ACTIVE_NOT_RECRUITING
Last Update Posted:
2023-12-05
First Post:
2022-01-21
Brief Title:
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction
Sponsor:
Karaganda Medical University
Organization:
Karaganda Medical University
Study Overview
Official Title:
Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction
Status:
ACTIVE_NOT_RECRUITING
Status Verified Date:
2023-10
Last Known Status:
None
Delayed Posting:
No
If Stopped, Why?:
Not Stopped
Has Expanded Access:
False
If Expanded Access, NCT#:
N/A
Has Expanded Access, NCT# Status:
N/A
Acronym:
None
Brief Summary:
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction ABO postoperative mortality ranges from 5 to 32 and complications occur up 23 of cases One of the formidable infectious and inflammatory complications of ABO is sepsis The main component of the development of sepsis in ABO is bacterial translocation BT BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs
Today there are several methods for detecting BT
1 direct method - the detection of 16s rRNA ribosomal ribonucleic acid in mesenteric lymph nodes MLN
2 indirect method - the detection of serum lipopolysaccharide-binding protein LBP and presepsin Soluble CD14 subtype or sCD14-ST
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation LBP sCD14-ST with the detection of microorganism genes 16s rRNA in mesenteric lymph nodes
Today there are several methods for detecting BT
1 direct method - the detection of 16s rRNA ribosomal ribonucleic acid in mesenteric lymph nodes MLN
2 indirect method - the detection of serum lipopolysaccharide-binding protein LBP and presepsin Soluble CD14 subtype or sCD14-ST
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation LBP sCD14-ST with the detection of microorganism genes 16s rRNA in mesenteric lymph nodes
Detailed Description:
For the early diagnosis of infectious and inflammatory complications it is necessary to study LBP sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction as well as in patients after planned surgical intervention for colon tumors Based on changes in bacterial translocation biomarkers in the blood serum its suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications
The study materials are blood serum and mesenteric lymph nodes MLN Venous blood sampling will be performed 1 hour before surgery 24 and 72 hours after it Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator It will be centrifuged for 20 minutes at 1000 x g after which the gel completely separates the serum from the clot forming a tight barrierELISA Kit for Lipopolysaccharide Binding Protein LBP Human and for Presepsin sCD14-ST Human from Cloud-Clone Corp will be used to determine any presence of LBP and sCD14-ST The analysis will be performed according to the manufacturers instructions for an ELISA EVOLIS robotic system from BioRad
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen MLN will be placed in a sterile tube without any fillers The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific USA in accordance with the manufacturers instructions The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC
During the implementation the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company NJSC Karaganda Medical University will be used
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan Grant No AP09260597
The study materials are blood serum and mesenteric lymph nodes MLN Venous blood sampling will be performed 1 hour before surgery 24 and 72 hours after it Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator It will be centrifuged for 20 minutes at 1000 x g after which the gel completely separates the serum from the clot forming a tight barrierELISA Kit for Lipopolysaccharide Binding Protein LBP Human and for Presepsin sCD14-ST Human from Cloud-Clone Corp will be used to determine any presence of LBP and sCD14-ST The analysis will be performed according to the manufacturers instructions for an ELISA EVOLIS robotic system from BioRad
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen MLN will be placed in a sterile tube without any fillers The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific USA in accordance with the manufacturers instructions The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC
During the implementation the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company NJSC Karaganda Medical University will be used
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan Grant No AP09260597
Study Oversight
Has Oversight DMC:
None
Is a FDA Regulated Drug?:
False
Is a FDA Regulated Device?:
False
Is an Unapproved Device?:
None
Is a PPSD?:
None
Is a US Export?:
None
Is an FDA AA801 Violation?:
None