Ignite Creation Date:
2024-05-06 @ 2:42 PM
Last Modification Date:
2024-10-26 @ 1:35 PM
Study NCT ID:
NCT04400981
Status:
RECRUITING
Last Update Posted:
2024-05-21
First Post:
2020-05-18
Brief Title:
Clinical Trial on Remote Ischemic Conditioning in Acute Ischemic Stroke Within 9 Hours of Onset in Patients Ineligible to Recanalization Therapies
Sponsor:
University of Milano Bicocca
Organization:
University of Milano Bicocca
Study Overview
Official Title:
Multi-center Randomized Pilot Clinical Trial on Remote Ischemic Conditioning in Acute Ischemic Stroke Within 9 Hours of Onset in Patients Ineligible to Recanalization Therapies
Status:
RECRUITING
Status Verified Date:
2024-05
Last Known Status:
None
Delayed Posting:
No
If Stopped, Why?:
Not Stopped
Has Expanded Access:
False
If Expanded Access, NCT#:
N/A
Has Expanded Access, NCT# Status:
N/A
Acronym:
TRICS-9
Brief Summary:
Phase II prospective randomized multicenter open-label pilot clinical trial comparing remote ischemic conditioning RIC plus standard medical therapy to standard medical therapy alone in patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible to recanalization therapies
Detailed Description:
Funding This study is supported by a grant from the Ministry of Health PRIN 2017CY3J3W This funding source had no role in the design of this study and will not have any role during its execution analyses interpretation of the data reporting of the study or decision to submit results
Background Remote ischemic conditioning is an experimental therapy consisting in a transient ischemia applied in a certain body site with the aim of increasing ischemic tolerance in distant organs through the activation of endogenous protective mechanisms Ischemic per-conditioning is a sub-lethal ischemia applied while a harmful ischemia is ongoing whereas ischemic post-conditioning is a sub-lethal ischemia applied subsequent to the occurrence of a harmful ischemia Both of them have been proven to be neuroprotective to ischemic brain tissue in many exploratory single-centre pre-clinical studies Although the neuroprotective mechanisms remain elusive evidence supports the role of both humoral and neuronal factors such as the release of adenosine bradykinin and nitric oxide in the blood the activation of neuronal p-AKT and of several miRNAs a recent pre-clinical study conducted on experimental rat model of acute ischemic stroke also showed significantly increased mRNA levels of HIF-1α 24 hours after the application of remote ischemic conditioning suggesting a possible neuroprotective role of HIF-1α
Remote ischemic conditioning represents a potential translational strategy however despite many pre-clinical exploratory studies highlighted its neuroprotective effect only a few clinical trials have been conducted so far
RESCUE BRAIN is an ongoing multicenter clinical trial on remote ischemic conditioning applied within 6 hours of stroke onset through intermittent lower limb ischemia The efficacy of remote ischemic conditioning has been assessed by measuring brain infarct growth from baseline to 24h through MRI DWI sequences and comparing brain infarct growth of a cohort of patients treated with remote ischemic conditioning plus standard medical therapy to that of a cohort treated with standard medical therapy alone A potential limit of this trial is represented by the inclusion of stroke patients that received either or both thrombolysis and mechanical thrombectomy In fact as these treatments are highly effective if applied promptly they may conceal the effect of remote ischemic conditioning when administered in addition to it making it difficult to selectively investigate its efficacy
In a previous single-center clinical trial remote ischemic per-conditioning induced by intermittent upper arm ischemia had been applied to patients with suspected acute ischemic stroke during transportation to hospital as an adjunct to thrombolysis and prior to its administration The efficacy of remote ischemic per-conditioning has been assessed by measuring penumbral salvage final infarct size at 1 month infarct growth at 1 month and evaluating clinical outcome after 3 months Although the overall results were neutral patients treated with remote ischemic per-conditioning showed lower NIHSS scores and higher frequency of TIA than controls together with an overall reduction in risk of brain tissue infarction suggesting a fast-acting neuroprotective effect moreover remote ischemic conditioning resulted to be safe and highly tolerable The latter observation has also been confirmed in RECAST a single-center study on tolerability and feasibility of remote ischemic conditioning applied to mildly symptomatic patients within 24h of stroke onset The RECAST trial also demonstrated increased plasmatic levels of HSP27 at 4 days in the intervention group suggesting its possible role in neuroprotection and indicating HSP27 as a potential biomarker of neuroprotection11
Based on these observations the Italian Stroke Organization ISO Basic Science Network which is a nationwide network that promotes translational research on acute ischemic stroke launched a multicenter translational research program on remote ischemic conditioning This program provided for a pre-clinical study on animal model of experimental ischemic stroke and a pilot clinical trial involving patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible for recanalization therapies
Current guidelines for ischemic stroke recommend thrombolysis within 45 hours and thrombectomy within 6 hours of stroke onset for all eligible patients but also allow administration of recanalization therapies beyond the abovementioned time window in selected patients according to the results of DAWN DEFUSE and WAKE-UP trial
The DAWN trial Clinical Mismatch in the Triage of Wake Up and Late Presenting Strokes Undergoing Neurointervention With Trevo used clinical-radiological mismatch to select patients with large anterior circulation vessel occlusion for mechanical thrombectomy 6 hours to 24 hours from last time known normal The DEFUSE 3 trial Diffusion and Perfusion Imaging Evaluation for Understanding Stroke Evolution used perfusion-core mismatch and maximum core size as radiological criteria to select patients with large anterior circulation occlusion between 6 hours and 16 hours from last time known well for mechanical thrombectomy Both trials demonstrated an overall benefit in functional outcome at 90 days in the subgroup of patients in the endovascular arm that were treated with mechanical thrombectomy 6 hours from onset
The WAKE-UP trial MRI-Guided Thrombolysis for Stroke with Unknown Time of Onset enrolled patients with stroke on awakening or with unclear time of onset and that presented with MRI mismatch between abnormal signal on DWI and no abnormalities on FLAIR The patient either noticed stroke symptoms on awakening or could not report the timing of symptom onset due to neurological deficits eg aphasia anathria confusion the time interval between the patient was last known to be well and symptom recognition was 45 hours without upper limit in order to exclude patients otherwise eligible to thrombolysis This trial provided evidence of benefit from thrombolysis within 45 hours of stroke symptom recognition
Finally the EXTEND trial Thrombolysis Guided by Perfusion Imaging up to 9 Hours after Onset of Stroke enrolled patients with stroke onset between 45 hours and 9 hours and those with stroke on awakening within 9 hours of the midpoint of sleep who had salvageable brain tissue on perfusion imaging This trial demonstrated that thrombolysis performed between 45 and 90 hours after stroke onset or at the time the patient awoke with stroke symptoms if within 9 hours of midpoint of sleep resulted in a higher percentage of patients with no or minor neurologic deficits than those who were given placebo
These evidences lead to rethinking the paradigm time is brain adding greater consciousness that time on the ischemic process is relative although the longer treatment is delayed the worse the functional outcome penumbral transformation into irreversible brain injury within a given time interval varies in relation to multiple factors In this context the aim of this study is to explore remote ischemic conditioning as a neuroprotective therapy in acute ischemic stroke within an extended time window of 9 hours of stroke onset
Primary objective to assess whether RIC plus standard medical therapy applied within 9 hours of ischemic stroke onset is superior to standard medical therapy alone in obtaining early neurological improvement defined as the percent change in the National Institute of Health stroke scale NIHSS between admission and 72 hours after randomization in patients with acute ischemic stroke ineligible for recanalization therapies
Secondary objectives
Evaluate intervention feasibility ie estimate the proportion of patients randomized to the active arm of the trial who successfully complete the RIC treatment
Estimate the added impact of the RIC therapy on the following outcomes early neurological improvement at 24 hours and 48 hours after randomization neuroprotection based on blood and plasma biomarkers degree of disability or dependence in the daily activities at three months assessed by the modified Rankin Scale
Trial design Phase II prospective block randomized multicenter open-label clinical trial comparing with a 11 allocation ratio RIC plus standard medical therapy to standard medical therapy alone in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis andor thrombectomy The primary null hypothesis of this trial is that there is no difference in early neurological improvement between RIC plus standard medical therapy and standard medical therapy alone
Study setting The experimental intervention will be carried out in three Italian Comprehensive Stroke Centers belonging to ISO-associated academic hospitals represented by ASST Monza-Ospedale San Gerardo di Monza Università degli Studi di Milano-Bicocca Azienda Ospedaliera SantAndrea Università degli Studi la Sapienza di Roma Ospedale di Avezzano Università degli Studi dellAquila
Methods
Experimental Intervention
1 Intervention arm RIC treatment arm plus standard medical therapy Remote ischemic conditioning will be applied immediately after randomization in the Emergency Department through a standard blood pressure cuff placed around the non-paretic arm The protocol includes 4 cycles of intermittent manually induced upper limb ischemia alternating 5 minutes of inflation 20mmHg above systolic blood pressure and 5 minutes of deflation
Patients randomized to remote ischemic conditioning will also receive standard medical therapy see below
2 Control arm Standard medical therapy alone Standard medical therapy will be administered immediately after randomization in the Emergency Department Standard medical therapy comprises single antiplatelet therapy either aspirin given in a total dose ranging between 100 to 300 mg per day on days 1-5 and followed by aspirin 100mgday on days 1-5 followed by aspirin 100mgday or Clopidogrel 75mgday at the discretion of the patients attending physician unless an indication for early anticoagulation eg atrial fibrillation mechanical heart valve deep venous thrombosis pulmonary embolism antiphospholipid antibody syndrome hypercoagulable state or dual antiplatelet therapy eg early carotid stenting is present
All patients will receive standard deep venous thrombosis DVT prevention therapy together with appropriate treatment for blood pressure control glycemic control and cholesterol reduction
Data collection
For each eligible patient the following data will be recorded by a designated investigator
Demographics age gender ethnicity
Cerebrovascular risk factors hypertension diabetes hyperlipidemia atrial fibrillation previous stroke or TIA ischemic heart disease peripheral vascular disease
Past medicalsurgical history
Medications prior to randomization antiplatelets anticoagulant antihypertensive statins
National Institute of Health Stroke Scale NIHSS prior to randomization at 24h 48h and 72h
Feasibility proportion of patients able to terminate RIC
Wong-Baker faces pain rating scale immediately after RIC and 72h after randomization
CT-head at randomization and within 72h of randomization
Etiology according to TOAST classification at the time of discharge
Disability at 3 months through modified Rankin Scale
Adverse events at 3 months
Plasma Biomarkers in acute ischemic stroke patients Drawing of 7 mL of peripheral venous blood will be performed at 24h and 72h after RIC
HIF-1α mRNA levels at 24 hours Total RNA will be extracted from whole blood and transcribed into cDNA Quantitative reverse transcription polymerase chain reaction HIF1a F TCATCCAAG- GAGCCTTAACC HIF-1a R AAGCGACATAGTAGGGGCAC will be performed Takara Bio CA USA GAPDH will be chosen as the housekeeping gene
HSP27 plasma levels at 72 hours Plasma will be obtained by centrifugation and stored at - 20C HSP27 human will be quantified using a colorimetric enzyme immunoassay ELISA kit Enzo Life Sciences Roma Italy
Study duration
The investigation will be conducted for an estimated duration of 3 years
Phase 1 Administrative and ethical procedures 10 months
Phase 2 Duration of patient enrolment 18 months
Phase 3 Follow-up period 3 months from the date of randomization
Phase 4 Database lock statistical analysis and production of a scientific report 32-36 month
Planned start of enrolment upon approval by the Ethics committee and reception of the signed contract
Study design This is a phase II prospective block randomized multicenter open-label clinical trial comparing with a 11 allocation ratio RIC plus standard medical therapy to standard medical therapy alone in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis andor thrombectomy The primary null hypothesis is that there is no or negligible difference in clinical benefit between remote ischemic conditioning plus standard medical therapy and standard medical therapy alone
Sample size An estimated total sample size of 80 patients 40 patients in each arm should yield 80 power to detect a clinically significant difference of 20 40 in treatment vs 20 in control arm in the median percent change in NIHSS at 72 hours considering a standard deviation of 30 at two-sided statistical significance threshold of p 005 when using a Wilcoxon-Mann-Whitney test
Randomization A randomization list stratified by center will be produced using a pseudo-random number generator The result of the randomization will be delivered after personal data input in a web form
Statistical methods Descriptive analyses will be carried out using classification number and percentages in categorical variables and using moments and mediansquartiles in numerical variables Primary analysis of treatment effect on the early neurological improvement will be analysed using a Wilcoxon-Mann-Whitney test A secondary analysis on the primary outcome will be performed using a mixed linear regression including treatment and centers and unbalanced important baseline characteristics in case they are present Feasibility will be measured estimating the proportion of subjects who terminate RIC together with an exact 95 confidence limit Description of adverse events will be reported for all randomized subjects Population examined will be ITT Cut-off for statistical significance will be set at 005 two-tailed
Background Remote ischemic conditioning is an experimental therapy consisting in a transient ischemia applied in a certain body site with the aim of increasing ischemic tolerance in distant organs through the activation of endogenous protective mechanisms Ischemic per-conditioning is a sub-lethal ischemia applied while a harmful ischemia is ongoing whereas ischemic post-conditioning is a sub-lethal ischemia applied subsequent to the occurrence of a harmful ischemia Both of them have been proven to be neuroprotective to ischemic brain tissue in many exploratory single-centre pre-clinical studies Although the neuroprotective mechanisms remain elusive evidence supports the role of both humoral and neuronal factors such as the release of adenosine bradykinin and nitric oxide in the blood the activation of neuronal p-AKT and of several miRNAs a recent pre-clinical study conducted on experimental rat model of acute ischemic stroke also showed significantly increased mRNA levels of HIF-1α 24 hours after the application of remote ischemic conditioning suggesting a possible neuroprotective role of HIF-1α
Remote ischemic conditioning represents a potential translational strategy however despite many pre-clinical exploratory studies highlighted its neuroprotective effect only a few clinical trials have been conducted so far
RESCUE BRAIN is an ongoing multicenter clinical trial on remote ischemic conditioning applied within 6 hours of stroke onset through intermittent lower limb ischemia The efficacy of remote ischemic conditioning has been assessed by measuring brain infarct growth from baseline to 24h through MRI DWI sequences and comparing brain infarct growth of a cohort of patients treated with remote ischemic conditioning plus standard medical therapy to that of a cohort treated with standard medical therapy alone A potential limit of this trial is represented by the inclusion of stroke patients that received either or both thrombolysis and mechanical thrombectomy In fact as these treatments are highly effective if applied promptly they may conceal the effect of remote ischemic conditioning when administered in addition to it making it difficult to selectively investigate its efficacy
In a previous single-center clinical trial remote ischemic per-conditioning induced by intermittent upper arm ischemia had been applied to patients with suspected acute ischemic stroke during transportation to hospital as an adjunct to thrombolysis and prior to its administration The efficacy of remote ischemic per-conditioning has been assessed by measuring penumbral salvage final infarct size at 1 month infarct growth at 1 month and evaluating clinical outcome after 3 months Although the overall results were neutral patients treated with remote ischemic per-conditioning showed lower NIHSS scores and higher frequency of TIA than controls together with an overall reduction in risk of brain tissue infarction suggesting a fast-acting neuroprotective effect moreover remote ischemic conditioning resulted to be safe and highly tolerable The latter observation has also been confirmed in RECAST a single-center study on tolerability and feasibility of remote ischemic conditioning applied to mildly symptomatic patients within 24h of stroke onset The RECAST trial also demonstrated increased plasmatic levels of HSP27 at 4 days in the intervention group suggesting its possible role in neuroprotection and indicating HSP27 as a potential biomarker of neuroprotection11
Based on these observations the Italian Stroke Organization ISO Basic Science Network which is a nationwide network that promotes translational research on acute ischemic stroke launched a multicenter translational research program on remote ischemic conditioning This program provided for a pre-clinical study on animal model of experimental ischemic stroke and a pilot clinical trial involving patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible for recanalization therapies
Current guidelines for ischemic stroke recommend thrombolysis within 45 hours and thrombectomy within 6 hours of stroke onset for all eligible patients but also allow administration of recanalization therapies beyond the abovementioned time window in selected patients according to the results of DAWN DEFUSE and WAKE-UP trial
The DAWN trial Clinical Mismatch in the Triage of Wake Up and Late Presenting Strokes Undergoing Neurointervention With Trevo used clinical-radiological mismatch to select patients with large anterior circulation vessel occlusion for mechanical thrombectomy 6 hours to 24 hours from last time known normal The DEFUSE 3 trial Diffusion and Perfusion Imaging Evaluation for Understanding Stroke Evolution used perfusion-core mismatch and maximum core size as radiological criteria to select patients with large anterior circulation occlusion between 6 hours and 16 hours from last time known well for mechanical thrombectomy Both trials demonstrated an overall benefit in functional outcome at 90 days in the subgroup of patients in the endovascular arm that were treated with mechanical thrombectomy 6 hours from onset
The WAKE-UP trial MRI-Guided Thrombolysis for Stroke with Unknown Time of Onset enrolled patients with stroke on awakening or with unclear time of onset and that presented with MRI mismatch between abnormal signal on DWI and no abnormalities on FLAIR The patient either noticed stroke symptoms on awakening or could not report the timing of symptom onset due to neurological deficits eg aphasia anathria confusion the time interval between the patient was last known to be well and symptom recognition was 45 hours without upper limit in order to exclude patients otherwise eligible to thrombolysis This trial provided evidence of benefit from thrombolysis within 45 hours of stroke symptom recognition
Finally the EXTEND trial Thrombolysis Guided by Perfusion Imaging up to 9 Hours after Onset of Stroke enrolled patients with stroke onset between 45 hours and 9 hours and those with stroke on awakening within 9 hours of the midpoint of sleep who had salvageable brain tissue on perfusion imaging This trial demonstrated that thrombolysis performed between 45 and 90 hours after stroke onset or at the time the patient awoke with stroke symptoms if within 9 hours of midpoint of sleep resulted in a higher percentage of patients with no or minor neurologic deficits than those who were given placebo
These evidences lead to rethinking the paradigm time is brain adding greater consciousness that time on the ischemic process is relative although the longer treatment is delayed the worse the functional outcome penumbral transformation into irreversible brain injury within a given time interval varies in relation to multiple factors In this context the aim of this study is to explore remote ischemic conditioning as a neuroprotective therapy in acute ischemic stroke within an extended time window of 9 hours of stroke onset
Primary objective to assess whether RIC plus standard medical therapy applied within 9 hours of ischemic stroke onset is superior to standard medical therapy alone in obtaining early neurological improvement defined as the percent change in the National Institute of Health stroke scale NIHSS between admission and 72 hours after randomization in patients with acute ischemic stroke ineligible for recanalization therapies
Secondary objectives
Evaluate intervention feasibility ie estimate the proportion of patients randomized to the active arm of the trial who successfully complete the RIC treatment
Estimate the added impact of the RIC therapy on the following outcomes early neurological improvement at 24 hours and 48 hours after randomization neuroprotection based on blood and plasma biomarkers degree of disability or dependence in the daily activities at three months assessed by the modified Rankin Scale
Trial design Phase II prospective block randomized multicenter open-label clinical trial comparing with a 11 allocation ratio RIC plus standard medical therapy to standard medical therapy alone in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis andor thrombectomy The primary null hypothesis of this trial is that there is no difference in early neurological improvement between RIC plus standard medical therapy and standard medical therapy alone
Study setting The experimental intervention will be carried out in three Italian Comprehensive Stroke Centers belonging to ISO-associated academic hospitals represented by ASST Monza-Ospedale San Gerardo di Monza Università degli Studi di Milano-Bicocca Azienda Ospedaliera SantAndrea Università degli Studi la Sapienza di Roma Ospedale di Avezzano Università degli Studi dellAquila
Methods
Experimental Intervention
1 Intervention arm RIC treatment arm plus standard medical therapy Remote ischemic conditioning will be applied immediately after randomization in the Emergency Department through a standard blood pressure cuff placed around the non-paretic arm The protocol includes 4 cycles of intermittent manually induced upper limb ischemia alternating 5 minutes of inflation 20mmHg above systolic blood pressure and 5 minutes of deflation
Patients randomized to remote ischemic conditioning will also receive standard medical therapy see below
2 Control arm Standard medical therapy alone Standard medical therapy will be administered immediately after randomization in the Emergency Department Standard medical therapy comprises single antiplatelet therapy either aspirin given in a total dose ranging between 100 to 300 mg per day on days 1-5 and followed by aspirin 100mgday on days 1-5 followed by aspirin 100mgday or Clopidogrel 75mgday at the discretion of the patients attending physician unless an indication for early anticoagulation eg atrial fibrillation mechanical heart valve deep venous thrombosis pulmonary embolism antiphospholipid antibody syndrome hypercoagulable state or dual antiplatelet therapy eg early carotid stenting is present
All patients will receive standard deep venous thrombosis DVT prevention therapy together with appropriate treatment for blood pressure control glycemic control and cholesterol reduction
Data collection
For each eligible patient the following data will be recorded by a designated investigator
Demographics age gender ethnicity
Cerebrovascular risk factors hypertension diabetes hyperlipidemia atrial fibrillation previous stroke or TIA ischemic heart disease peripheral vascular disease
Past medicalsurgical history
Medications prior to randomization antiplatelets anticoagulant antihypertensive statins
National Institute of Health Stroke Scale NIHSS prior to randomization at 24h 48h and 72h
Feasibility proportion of patients able to terminate RIC
Wong-Baker faces pain rating scale immediately after RIC and 72h after randomization
CT-head at randomization and within 72h of randomization
Etiology according to TOAST classification at the time of discharge
Disability at 3 months through modified Rankin Scale
Adverse events at 3 months
Plasma Biomarkers in acute ischemic stroke patients Drawing of 7 mL of peripheral venous blood will be performed at 24h and 72h after RIC
HIF-1α mRNA levels at 24 hours Total RNA will be extracted from whole blood and transcribed into cDNA Quantitative reverse transcription polymerase chain reaction HIF1a F TCATCCAAG- GAGCCTTAACC HIF-1a R AAGCGACATAGTAGGGGCAC will be performed Takara Bio CA USA GAPDH will be chosen as the housekeeping gene
HSP27 plasma levels at 72 hours Plasma will be obtained by centrifugation and stored at - 20C HSP27 human will be quantified using a colorimetric enzyme immunoassay ELISA kit Enzo Life Sciences Roma Italy
Study duration
The investigation will be conducted for an estimated duration of 3 years
Phase 1 Administrative and ethical procedures 10 months
Phase 2 Duration of patient enrolment 18 months
Phase 3 Follow-up period 3 months from the date of randomization
Phase 4 Database lock statistical analysis and production of a scientific report 32-36 month
Planned start of enrolment upon approval by the Ethics committee and reception of the signed contract
Study design This is a phase II prospective block randomized multicenter open-label clinical trial comparing with a 11 allocation ratio RIC plus standard medical therapy to standard medical therapy alone in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis andor thrombectomy The primary null hypothesis is that there is no or negligible difference in clinical benefit between remote ischemic conditioning plus standard medical therapy and standard medical therapy alone
Sample size An estimated total sample size of 80 patients 40 patients in each arm should yield 80 power to detect a clinically significant difference of 20 40 in treatment vs 20 in control arm in the median percent change in NIHSS at 72 hours considering a standard deviation of 30 at two-sided statistical significance threshold of p 005 when using a Wilcoxon-Mann-Whitney test
Randomization A randomization list stratified by center will be produced using a pseudo-random number generator The result of the randomization will be delivered after personal data input in a web form
Statistical methods Descriptive analyses will be carried out using classification number and percentages in categorical variables and using moments and mediansquartiles in numerical variables Primary analysis of treatment effect on the early neurological improvement will be analysed using a Wilcoxon-Mann-Whitney test A secondary analysis on the primary outcome will be performed using a mixed linear regression including treatment and centers and unbalanced important baseline characteristics in case they are present Feasibility will be measured estimating the proportion of subjects who terminate RIC together with an exact 95 confidence limit Description of adverse events will be reported for all randomized subjects Population examined will be ITT Cut-off for statistical significance will be set at 005 two-tailed
Study Oversight
Has Oversight DMC:
None
Is a FDA Regulated Drug?:
False
Is a FDA Regulated Device?:
False
Is an Unapproved Device?:
None
Is a PPSD?:
None
Is a US Export?:
None
Is an FDA AA801 Violation?:
None