Ignite Creation Date:
2024-05-05 @ 11:51 AM
Last Modification Date:
2024-10-26 @ 9:15 AM
Study NCT ID:
NCT00155779
Status:
COMPLETED
Last Update Posted:
2005-09-12
First Post:
2005-09-09
Brief Title:
ACE Gene Polymorphism and ARDS Outcome
Sponsor:
National Taiwan University Hospital
Organization:
National Taiwan University Hospital
Study Overview
Official Title:
Polymorphism of the Angiotensin-Converting Enzyme Gene and the Outcome of Acute Respiratory Distress Syndrome
Status:
COMPLETED
Status Verified Date:
2003-12
Last Known Status:
None
Delayed Posting:
No
If Stopped, Why?:
Not Stopped
Has Expanded Access:
False
If Expanded Access, NCT#:
N/A
Has Expanded Access, NCT# Status:
N/A
Acronym:
None
Brief Summary:
The acute respiratory distress syndrome ARDS is an important cause of acute respiratory failure with a high mortality rate The mechanism of resolution of the late organizing phase remains uncertain The ACE gene contains a polymorphism based on the presence insertion I or absence deletion D within an intron of a 287-bp nonsense DNA domain resulting in three genotypes DD and II homozygotes and ID heterozygotes It has been shown that ID polymorphism of ACE gene may account for half the variance of serum ACE levels in the Caucasians Polymorphism of the ACE gene has also been shown to contribute to the development of some respiratory diseases We hypothesize that the presence of ACE gene polymorphism can affect the outcome of ARDS The objective of this proposed study is to determine the genotypes of ACE gene polymorphism and assess the influence of ACE genotype on the outcome and pulmonary resolution of patients with ARDS Patients diagnosed to have ARDS are eligible for possible inclusion into the study The ACE genotype of all patients with ARDS will be determined by polymerase chain reaction PCR amplification of the respective fragment for the D and I alleles from intron 16 of the ACE gene and size fractionation by electrophoresis The outcome of patients with ARDS in the three genotypes will be compared
Detailed Description:
Study Design This was a observational study of patients with ARDS The study was reviewed and approved by the Institutional Review Board of the National Taiwan University Hospital Patients admitted to the medical ICU at the National Taiwan University Hospital were screened for eligibility Patients were considered eligible if they were over 18 years of age and fulfilled the American-European Consensus Committee criteria for ARDS a acute onset b bilateral pulmonary infiltrates c severely impaired oxygenation ie PaO2FIO2 200 mmHg and d pulmonary artery occlusion pressure 18 mmHg or no evidence of left atrial hypertension 1
Exclusion criteria were a a previous history of ARDS b received angiotensin-converting enzyme inhibitor or angiotensin receptor antagonist within one month before the development of ARDS c receiving mechanical ventilation due to chronic respiratory failure and d did not receive invasive mechanical ventilation after the occurrence of ARDS If a patient had repeated episodes of ARDS during the study period only the first episode would be studied and included for analysis The diagnosis of sepsis was based on the criteria by the American College of Chest PhysiciansSociety of Critical Care Medicine Consensus Conference Committee 21
In addition two control groups consisting at-risk patients and non-at-risk respectively were recruited for comparison The patients in the at-risk group were all admitted to the MICU due to acute respiratory failure but did not meet the diagnostic criteria of ARDS throughout the hospital course The non-at-risk group had no previous history of respiratory failure or admission to the ICU for any reason and had not been hospitalized within 6 months before inclusion
Clinical Data Collection and Outcome For the ARDS and at-risk groups the following data were collected on admission to the ICU co-morbidities Acute Physiology and Chronic Health Evaluation APACHE II scores 22 gender age and reason for admission For the ARDS groups the Lung Injury Scores LIS were measured at the time of diagnosis of ARDS23 For the at-risk group the highest lung LISs were also recorded During the MICU admission the best PaO2FIO2 and the mode of mechanical ventilation were recorded daily and major organ functions serum creatinine blood cell and platelet counts serum alanine aminotransferase were regularly determined Decisions on specific supportive treatments for ARDS prone positioning inhaled nitric oxide high-frequency oscillation ventilation etc weaning and extubation were determined by the attending physicians according to the clinical condition and test for eligibility of extubation The primary outcome of this study was the survival at the 28th day of ARDS onset The secondary outcome was the survival on hospital discharge
ACE Polymorphism After informed consents were obtained from the patients and control subjects peripheral blood samples were obtained and enediaminetetraacetic acid EDTA was added Genomic DNA was extracted using commercial kits QIAamp DNA Blood Mini Kit Qiagen Valencia CA according to the manufacturers instructions and stored at -20C at a concentration of 100 ngL until further genotyping studies The ACE ID genotypes were determined by PCR amplification of the respective fragments for the D and I alleles from intron 16 of the ACE gene and by size fractionation by electrophoresis as previously described elsewhere 24 Standard PCR was performed with 20 pmol of each primer 5CTGGAGACCACTCCCATCCTTTCT3 and 5GATGTGGCCATCACATTCGTCAGAT3 in a final volume of 25 L containing 15 mM MgCl2 50 mM KCl 10 mM Tris-HCl pH 83 02 mM of each dNTP and 125 units if Taq polymerase Perkin Elmer-Cetus Norwalk Conn The DNA was amplified for 30 cycles with denaturation at 94C for 30 s annealing at 58C for 30 s and extension at 72C for 1 min followed by final extension at 72C for 5 min DNA Thermal Cycler 480 Perkin Elmer-Cetus The PCR products were electrophoresed in a 2 agarose gels with 5 g of ethidium bromidemL and were identified by 300-nm ultraviolet transillumination as distinct bands D allele 191 bp I allele 478 bp Because of the concerns about mistyping ID as DD all samples found to have the DD genotype were subjected to a second independent PCR amplification with a primer pair that recognizes an insertion-specific sequence 5TGGGACCACAGCGCCCGCCACTAC3 and 5TCGCCAGCCCTCCCATGCCCATAA3 25 The PCR condition has been described elsewhere25 The reaction yields a 335-bp amplicon only in the presence of an I allele and no product in samples homozygous for DD
Statistical Analysis The SPSS statistical package version 101 for Windows SPSS Chicago IL was used for most of the statistical analyses Continuous data were expressed as means SD Comparisons of the continuous data were performed by ANOVA or two-sample t tests The chi-square tables were used to compare the observed number of each genotype with those expected for a population in a Hardy-Weinberg equilibrium and to compare genotype frequencies between the ARDS population and the control groups The 28-day survival and survival on hospital discharge between the genotypes were estimated by the Kaplan-Meier method and the statistical significances were tested using the log-rank test Multivariate analyses for the primary and secondary outcomes were performed by the Cox proportional hazard methods For all tests a p value of 005 or less was considered significant
Exclusion criteria were a a previous history of ARDS b received angiotensin-converting enzyme inhibitor or angiotensin receptor antagonist within one month before the development of ARDS c receiving mechanical ventilation due to chronic respiratory failure and d did not receive invasive mechanical ventilation after the occurrence of ARDS If a patient had repeated episodes of ARDS during the study period only the first episode would be studied and included for analysis The diagnosis of sepsis was based on the criteria by the American College of Chest PhysiciansSociety of Critical Care Medicine Consensus Conference Committee 21
In addition two control groups consisting at-risk patients and non-at-risk respectively were recruited for comparison The patients in the at-risk group were all admitted to the MICU due to acute respiratory failure but did not meet the diagnostic criteria of ARDS throughout the hospital course The non-at-risk group had no previous history of respiratory failure or admission to the ICU for any reason and had not been hospitalized within 6 months before inclusion
Clinical Data Collection and Outcome For the ARDS and at-risk groups the following data were collected on admission to the ICU co-morbidities Acute Physiology and Chronic Health Evaluation APACHE II scores 22 gender age and reason for admission For the ARDS groups the Lung Injury Scores LIS were measured at the time of diagnosis of ARDS23 For the at-risk group the highest lung LISs were also recorded During the MICU admission the best PaO2FIO2 and the mode of mechanical ventilation were recorded daily and major organ functions serum creatinine blood cell and platelet counts serum alanine aminotransferase were regularly determined Decisions on specific supportive treatments for ARDS prone positioning inhaled nitric oxide high-frequency oscillation ventilation etc weaning and extubation were determined by the attending physicians according to the clinical condition and test for eligibility of extubation The primary outcome of this study was the survival at the 28th day of ARDS onset The secondary outcome was the survival on hospital discharge
ACE Polymorphism After informed consents were obtained from the patients and control subjects peripheral blood samples were obtained and enediaminetetraacetic acid EDTA was added Genomic DNA was extracted using commercial kits QIAamp DNA Blood Mini Kit Qiagen Valencia CA according to the manufacturers instructions and stored at -20C at a concentration of 100 ngL until further genotyping studies The ACE ID genotypes were determined by PCR amplification of the respective fragments for the D and I alleles from intron 16 of the ACE gene and by size fractionation by electrophoresis as previously described elsewhere 24 Standard PCR was performed with 20 pmol of each primer 5CTGGAGACCACTCCCATCCTTTCT3 and 5GATGTGGCCATCACATTCGTCAGAT3 in a final volume of 25 L containing 15 mM MgCl2 50 mM KCl 10 mM Tris-HCl pH 83 02 mM of each dNTP and 125 units if Taq polymerase Perkin Elmer-Cetus Norwalk Conn The DNA was amplified for 30 cycles with denaturation at 94C for 30 s annealing at 58C for 30 s and extension at 72C for 1 min followed by final extension at 72C for 5 min DNA Thermal Cycler 480 Perkin Elmer-Cetus The PCR products were electrophoresed in a 2 agarose gels with 5 g of ethidium bromidemL and were identified by 300-nm ultraviolet transillumination as distinct bands D allele 191 bp I allele 478 bp Because of the concerns about mistyping ID as DD all samples found to have the DD genotype were subjected to a second independent PCR amplification with a primer pair that recognizes an insertion-specific sequence 5TGGGACCACAGCGCCCGCCACTAC3 and 5TCGCCAGCCCTCCCATGCCCATAA3 25 The PCR condition has been described elsewhere25 The reaction yields a 335-bp amplicon only in the presence of an I allele and no product in samples homozygous for DD
Statistical Analysis The SPSS statistical package version 101 for Windows SPSS Chicago IL was used for most of the statistical analyses Continuous data were expressed as means SD Comparisons of the continuous data were performed by ANOVA or two-sample t tests The chi-square tables were used to compare the observed number of each genotype with those expected for a population in a Hardy-Weinberg equilibrium and to compare genotype frequencies between the ARDS population and the control groups The 28-day survival and survival on hospital discharge between the genotypes were estimated by the Kaplan-Meier method and the statistical significances were tested using the log-rank test Multivariate analyses for the primary and secondary outcomes were performed by the Cox proportional hazard methods For all tests a p value of 005 or less was considered significant
Study Oversight
Has Oversight DMC:
None
Is a FDA Regulated Drug?:
None
Is a FDA Regulated Device?:
None
Is an Unapproved Device?:
None
Is a PPSD?:
None
Is a US Export?:
None
Is an FDA AA801 Violation?:
None